ID: 1072673278

View in Genome Browser
Species Human (GRCh38)
Location 10:97447042-97447064
Sequence CTGCGGTCCGATCCTCTTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072673270_1072673278 19 Left 1072673270 10:97447000-97447022 CCTCCGGCCTTTTCCCGGTTTTT No data
Right 1072673278 10:97447042-97447064 CTGCGGTCCGATCCTCTTCGCGG No data
1072673272_1072673278 12 Left 1072673272 10:97447007-97447029 CCTTTTCCCGGTTTTTTAAACTG No data
Right 1072673278 10:97447042-97447064 CTGCGGTCCGATCCTCTTCGCGG No data
1072673271_1072673278 16 Left 1072673271 10:97447003-97447025 CCGGCCTTTTCCCGGTTTTTTAA No data
Right 1072673278 10:97447042-97447064 CTGCGGTCCGATCCTCTTCGCGG No data
1072673268_1072673278 25 Left 1072673268 10:97446994-97447016 CCACTGCCTCCGGCCTTTTCCCG No data
Right 1072673278 10:97447042-97447064 CTGCGGTCCGATCCTCTTCGCGG No data
1072673274_1072673278 5 Left 1072673274 10:97447014-97447036 CCGGTTTTTTAAACTGCAGCTTC No data
Right 1072673278 10:97447042-97447064 CTGCGGTCCGATCCTCTTCGCGG No data
1072673273_1072673278 6 Left 1072673273 10:97447013-97447035 CCCGGTTTTTTAAACTGCAGCTT No data
Right 1072673278 10:97447042-97447064 CTGCGGTCCGATCCTCTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072673278 Original CRISPR CTGCGGTCCGATCCTCTTCG CGG Intronic