ID: 1072674166

View in Genome Browser
Species Human (GRCh38)
Location 10:97453221-97453243
Sequence CATCTGTGTGGAACAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072674166_1072674170 9 Left 1072674166 10:97453221-97453243 CCAGCTGCTGTTCCACACAGATG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1072674170 10:97453253-97453275 CTCCAGCTAGGCTGAAATATTGG 0: 1
1: 0
2: 0
3: 8
4: 94
1072674166_1072674169 -3 Left 1072674166 10:97453221-97453243 CCAGCTGCTGTTCCACACAGATG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1072674169 10:97453241-97453263 ATGTTTGGCTAACTCCAGCTAGG 0: 1
1: 0
2: 1
3: 9
4: 106
1072674166_1072674172 29 Left 1072674166 10:97453221-97453243 CCAGCTGCTGTTCCACACAGATG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1072674172 10:97453273-97453295 TGGCAGATTCATTTTACTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072674166 Original CRISPR CATCTGTGTGGAACAGCAGC TGG (reversed) Intronic
902914087 1:19625515-19625537 CAGCTGTGTGGCACTGAAGCCGG + Intronic
905528835 1:38660552-38660574 CATCTGTCTGGAGCAGCTGCAGG + Intergenic
906269549 1:44464565-44464587 CATCTGTGTGGCAGAGAAGATGG + Intronic
907246745 1:53113829-53113851 CATCAGTGTGACACAGCAGAAGG - Intronic
910209217 1:84776437-84776459 CATCTGGTTGGACCAGCATCTGG + Intergenic
911098710 1:94077075-94077097 CATATGTGTGTAAAAGCAGTTGG + Intronic
911161227 1:94684785-94684807 GAACTGTGTGGCACAGCACCCGG - Intergenic
911284061 1:95968888-95968910 GAGCTGTGTGGAGCAACAGCAGG - Intergenic
911627663 1:100144122-100144144 CATCTGTGTGGTATGGCAACAGG + Exonic
912351112 1:109014573-109014595 CAACTGTGTGCCACAGCACCCGG + Intronic
912655015 1:111478216-111478238 CACCTGTGTGAAACTGCAGTCGG + Exonic
913393311 1:118338715-118338737 AATCTGTGTGGCACAGAAGTGGG + Intergenic
916733179 1:167584270-167584292 CAGCTGTGAGGACCAGCCGCTGG - Intergenic
923144465 1:231188191-231188213 GCTCTGTGTGGGACAGGAGCAGG + Intronic
1062957346 10:1549058-1549080 CGTCTGAGGGGAACTGCAGCCGG + Intronic
1063709867 10:8467087-8467109 AATCTGTGTAGAACAGAGGCAGG - Intergenic
1063927304 10:10993109-10993131 CTTCGGTGGGAAACAGCAGCTGG - Intergenic
1064107460 10:12512054-12512076 GATGTGTTTGGAAAAGCAGCTGG + Intronic
1067372502 10:45698736-45698758 AACCTGTGTGGAACAGAAGGAGG - Intergenic
1067387277 10:45827388-45827410 AACCTGTGTGGAACAGAAGGAGG + Exonic
1067418852 10:46129863-46129885 AACCTGTGTGGAACAGAAGGAGG - Intergenic
1067447000 10:46357219-46357241 AACCTGTGTGGAACAGAAGGAGG - Intergenic
1067504205 10:46836452-46836474 AACCTGTGTGGAACAGAAGGAGG - Intergenic
1067590384 10:47503541-47503563 AACCTGTGTGGAACAGGAGGAGG + Exonic
1067637506 10:48011643-48011665 AACCTGTGTGGAACAGGAGGAGG + Intergenic
1067709738 10:48638306-48638328 CATCAGTGTGAAGCAGCAGCTGG + Intronic
1067875987 10:50008691-50008713 AACCTGTGTGGAACAGGAGGAGG - Exonic
1069340945 10:67407755-67407777 CATTCCTGTGGAACAACAGCAGG + Intronic
1069876149 10:71564223-71564245 CATTTCCATGGAACAGCAGCTGG + Intronic
1069896418 10:71682851-71682873 CCTCGGTGGGGAACAGGAGCTGG + Intronic
1070134101 10:73676072-73676094 AACCTGTGTGGAACAGAAGGAGG + Exonic
1072674166 10:97453221-97453243 CATCTGTGTGGAACAGCAGCTGG - Intronic
1073800819 10:107039549-107039571 AATCTTTCTGGAAAAGCAGCAGG + Intronic
1076441626 10:130484627-130484649 CTCCTGTGAGGAACAGGAGCTGG + Intergenic
1076485958 10:130817301-130817323 CGTTTGGCTGGAACAGCAGCCGG - Intergenic
1076507427 10:130987358-130987380 CACCTGTGTGGAGCTGTAGCAGG + Intergenic
1076856516 10:133117932-133117954 CCCCTGTCTGGGACAGCAGCTGG + Intronic
1078478994 11:11659808-11659830 CATCTGTGACTAGCAGCAGCCGG - Intergenic
1078853881 11:15190623-15190645 CATCTTAGTGGAACACCAGTGGG - Intronic
1081662464 11:44896486-44896508 CATCTGTGTGCACCAGCTTCAGG - Intronic
1082802647 11:57426018-57426040 GATCTGTGTGGACCAGATGCTGG - Exonic
1083870711 11:65486682-65486704 CAGCTGTGTGGACTAGCTGCTGG + Intergenic
1084172981 11:67409532-67409554 CATCTTTGAGGCCCAGCAGCTGG + Exonic
1085094824 11:73751593-73751615 CAGCTGTGTTGAACAGAAGAGGG - Intronic
1088428888 11:109735373-109735395 CCTGTGTGTGAAACAGCAGGTGG + Intergenic
1090158229 11:124464154-124464176 CACCTGTGTGGTAAGGCAGCAGG - Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090387153 11:126363985-126364007 CCACTGTGTGGAACCACAGCAGG - Intronic
1090480054 11:127059977-127059999 TCTCTGAGTGGAACAGCAGAGGG + Intergenic
1090625065 11:128600270-128600292 GAACTATGTGGAACTGCAGCTGG - Intergenic
1091792596 12:3280417-3280439 TCTCGGTGTGGTACAGCAGCAGG - Exonic
1092210562 12:6643646-6643668 CCTCTGTGTGGGGCAGCTGCAGG + Exonic
1092446615 12:8563882-8563904 CATCTTTCTGGAGCAGCAGCAGG - Intergenic
1092776704 12:11950072-11950094 GCTCTGGGTGGAACAGCTGCAGG - Intergenic
1095641470 12:44490450-44490472 AATCTGTGTGGAACAACTACAGG - Intergenic
1101462542 12:104911657-104911679 CATCTGTTTGGAACAGCCTAGGG - Intronic
1102028211 12:109725484-109725506 CAACTGTGTGTGCCAGCAGCCGG + Intronic
1102826782 12:115953434-115953456 CATTTATGTGTAACAGCAGCTGG + Intergenic
1104473158 12:129047481-129047503 TATCTGTGTGAAACAGACGCTGG + Intergenic
1104718563 12:131032024-131032046 TATCTGTGGGGCACAGCGGCAGG - Intronic
1105628904 13:22141578-22141600 CAGCCCTGTTGAACAGCAGCAGG - Intergenic
1105743790 13:23357090-23357112 CATTTGTGTGGAACATTAACTGG - Intronic
1106452688 13:29897201-29897223 CATCTGTGGGCGACAGCAGCGGG + Intergenic
1106508978 13:30396735-30396757 CCTCTGTGTGGAACCGCAAAGGG + Intergenic
1108155176 13:47577194-47577216 CCTCTGTGTGGAAAAGCTGCAGG - Intergenic
1108432048 13:50363607-50363629 CATCTGTGTGGAAAATCTGCCGG - Intronic
1108695944 13:52902468-52902490 TATTTCTGTGGAATAGCAGCAGG - Intergenic
1111221601 13:85211558-85211580 AATGTGTGTGGGTCAGCAGCAGG + Intergenic
1112676362 13:101706860-101706882 AATCTGTGTGAATCAGCAGATGG + Exonic
1112910736 13:104480200-104480222 CTTCTGTGTGGTACCGCAGATGG + Intergenic
1113259903 13:108550184-108550206 CAGCTGTGTCGAAGAGCAGATGG - Intergenic
1113411750 13:110096025-110096047 CATCCGGGTGGACCAGCATCTGG + Intergenic
1113815624 13:113168523-113168545 GACATGTGAGGAACAGCAGCAGG - Intronic
1115340237 14:32286040-32286062 CATTGGTGTGAAGCAGCAGCTGG - Intergenic
1118013243 14:61631572-61631594 CATCAGTGGGGGACAGGAGCTGG + Intronic
1118744351 14:68763101-68763123 CACTTGGCTGGAACAGCAGCCGG + Intergenic
1122724998 14:103744714-103744736 CATCTGTGTGACACAGAACCAGG + Intronic
1125407620 15:39369933-39369955 CATGTGTCTGGAAAAGCTGCAGG - Intergenic
1125448939 15:39787712-39787734 CCTCCGTGTAGAACAGCTGCAGG - Intergenic
1127619470 15:60719675-60719697 CAGTTCTGTGGAGCAGCAGCAGG - Intronic
1128165191 15:65457933-65457955 CATGTGTGTGCCACAGCACCTGG + Intronic
1128231518 15:66038831-66038853 CATCTGTGCCGAGCAGCACCTGG + Intronic
1131195143 15:90349425-90349447 CAGCTGTTTGGAAAAGCCGCCGG - Intergenic
1132020164 15:98354141-98354163 CTTCTGTGTGGGACTGGAGCTGG - Intergenic
1132103924 15:99049347-99049369 CAAATGTGTTGAAGAGCAGCTGG - Intergenic
1132709998 16:1262284-1262306 GAGCTGTGGGGAAAAGCAGCCGG + Intergenic
1133658347 16:7889162-7889184 CGTCTCTGTGTAACAGCAGCAGG + Intergenic
1133669873 16:8007885-8007907 CATTTGTCTGGAACAGCTGGGGG + Intergenic
1134136877 16:11682669-11682691 CATCTGTGTGGGCCAGGAGTTGG - Intronic
1135917064 16:26614726-26614748 CATCTCTCTGGGACATCAGCAGG + Intergenic
1138659618 16:58509500-58509522 CATCTGTGGGGCCCAGCATCCGG - Intronic
1140734830 16:77888983-77889005 CATCTGTTTGGAGCTGCAGTCGG + Intronic
1141336015 16:83156023-83156045 CAGCTGTGTAGAAGAGCATCTGG + Intronic
1142007258 16:87695405-87695427 CATCTGTGTCGCACAGCAGCAGG + Intronic
1142237050 16:88927343-88927365 CATCTGTGGGGAGAGGCAGCTGG + Intronic
1143367502 17:6417819-6417841 TGTTTGTGTGGAAGAGCAGCTGG - Intronic
1143982868 17:10885051-10885073 CAGCTGTGGGGCACAGCGGCAGG - Intergenic
1145217886 17:21065967-21065989 CCACTGTGTGGCAGAGCAGCAGG - Intergenic
1145888981 17:28401734-28401756 CGTCTGTGTTTAAAAGCAGCTGG - Exonic
1146629718 17:34461015-34461037 CAGCAGTGTGACACAGCAGCAGG - Intergenic
1146943569 17:36859834-36859856 CAGCTGTGGCGAGCAGCAGCTGG + Intergenic
1148894279 17:50831042-50831064 CATCTGTGTGGAACAGGACACGG - Intergenic
1150005176 17:61464634-61464656 CACCTTTGTGGAAGATCAGCTGG + Intronic
1150823016 17:68450895-68450917 CATCTGGGAGGAAAAGCAGCCGG + Exonic
1152063015 17:78093139-78093161 CACTTCTGTGCAACAGCAGCAGG + Intronic
1152282766 17:79395237-79395259 CCTCTGTGGAGAACAGCTGCAGG + Intronic
1154452696 18:14489760-14489782 CCCATGTGTGGGACAGCAGCAGG - Intergenic
1156401553 18:36744619-36744641 TATCTGTGGGGAGCAGGAGCCGG - Intronic
1157130352 18:45001587-45001609 CATCTTTGAGGAGGAGCAGCAGG + Intronic
1157969877 18:52254382-52254404 CATGGGTGTGGAACACAAGCTGG + Intergenic
1158242374 18:55391505-55391527 CATCTCTGTGAACCAGCAGTGGG + Intronic
1160993448 19:1871149-1871171 CATCTGTGAGGCTCTGCAGCAGG - Intergenic
1161085389 19:2332789-2332811 CTGCAGTGTGGCACAGCAGCTGG + Intronic
1161573303 19:5041830-5041852 GGTGTGTGTGGAACAGCAGCAGG + Intronic
1161669391 19:5596787-5596809 ATTCTGTGTGGATCAGCAGGAGG - Intronic
1166422562 19:42650363-42650385 CAGCTGCCTGGAACAGGAGCAGG + Intronic
1166426453 19:42683236-42683258 CTTCTGTGGTGAAAAGCAGCAGG + Intronic
1166496679 19:43307903-43307925 CAGCTGCCTGGAACAGGAGCAGG - Intergenic
1167103114 19:47416292-47416314 CAAGTGCGTGGAACAGCACCTGG - Intronic
1167332830 19:48867040-48867062 AATATGTGTGGAACGGCAGGAGG + Intronic
1167435352 19:49475642-49475664 GCTGTGTGTGGAACAGCAGAGGG + Intronic
1168326550 19:55541436-55541458 CATCTGCGTGGACCAGCCCCCGG + Exonic
926365082 2:12125649-12125671 CACCTGTGTGGAGAAGCACCTGG - Intergenic
927975293 2:27333997-27334019 CATCTGTGAGGAAAAAGAGCAGG + Exonic
928102653 2:28448584-28448606 CTTCTGTGTGGAGCAGAACCTGG + Intergenic
929175122 2:38968212-38968234 CAGCTGCGTGGAACTGGAGCTGG + Intronic
929349057 2:40925846-40925868 GATGTGTGTGGAAAATCAGCAGG + Intergenic
934683265 2:96301602-96301624 CATCTGTTTGACCCAGCAGCAGG + Exonic
935351447 2:102154684-102154706 CACCTGTGTGGAACATAAACTGG - Intronic
935363612 2:102267893-102267915 CATCTGTGACCAAAAGCAGCAGG - Intergenic
940275712 2:151938495-151938517 CATCTGTGTGCAAGTGGAGCAGG - Intronic
940607380 2:155943224-155943246 CAGCTTTGTCGAACAGCAGATGG - Intergenic
943780144 2:191814526-191814548 CATCAGGGTGTAACATCAGCTGG + Intergenic
946243351 2:218370487-218370509 CATCTGTGGGGAACCGAAACAGG + Intergenic
947331918 2:229037709-229037731 CCTCTGGGTGGAACAGCTCCAGG - Intronic
947772479 2:232681741-232681763 CATCTGTGAGGCACAGCTGTGGG - Exonic
948209919 2:236185329-236185351 CCTCAGTGTGGAAAAGCTGCAGG + Intergenic
1168926808 20:1588389-1588411 TTTCTCTGTGGATCAGCAGCTGG - Intronic
1170389589 20:15857537-15857559 CATGGGTGTGGAGTAGCAGCTGG - Intronic
1171339996 20:24420181-24420203 GATTTGTGTTCAACAGCAGCTGG + Intergenic
1171487705 20:25496198-25496220 CAGTTGTGTGGAACAGTGGCTGG - Intronic
1171884980 20:30645604-30645626 CTTCTGTTTGGAACAGTAGGAGG - Intergenic
1173265884 20:41480238-41480260 ACTCTGTGGGGAACAGCAACAGG + Intronic
1174052731 20:47778578-47778600 CTTCTGGGTGGAACAGCTGTTGG - Intronic
1176443337 21:6798524-6798546 CCCATGTGTGGGACAGCAGCAGG + Intergenic
1176821505 21:13663571-13663593 CCCATGTGTGGGACAGCAGCAGG + Intergenic
1177676570 21:24308638-24308660 CATCAGCCTGGAAAAGCAGCAGG - Intergenic
1179055172 21:37925174-37925196 CATTGGTGTGAAGCAGCAGCTGG + Intergenic
1180033493 21:45228933-45228955 GGTCTGTGTGGTACAGCTGCAGG + Intergenic
1180041735 21:45283705-45283727 CATCAGCGTGCAACTGCAGCTGG + Intronic
1180220859 21:46356954-46356976 GCTCTGTGTGGAAAAGGAGCAGG - Exonic
1180800573 22:18630049-18630071 CATCTGTCAGGACCAGCGGCTGG - Intergenic
1180851805 22:19025606-19025628 CATCTGTCAGGACCAGCGGCTGG - Intergenic
1181221146 22:21365213-21365235 CATCTGTCAGGACCAGCGGCTGG + Intergenic
1182035980 22:27198691-27198713 CTTCTGTGGGGAAAAGGAGCTGG + Intergenic
1182477884 22:30586298-30586320 CAGCTGTGTGGCACATGAGCTGG - Intronic
1185186494 22:49404114-49404136 CCTCTCTGTGGAACACCAGGTGG + Intergenic
1185287832 22:50010452-50010474 CGCCTGTGTGGAACTGCAGGGGG + Intronic
1185400412 22:50612806-50612828 CACCTGAGTGGAAGAGCAGAGGG - Intronic
949158322 3:852560-852582 CTTCTGGGTGTAACAGGAGCAGG - Intergenic
950915840 3:16644486-16644508 TATTGGTGTGGAACCGCAGCTGG + Intronic
951530369 3:23693192-23693214 CATATGTGGGGAAGAGCATCAGG - Intergenic
954110883 3:48432267-48432289 TATCTGTGTGGCTCACCAGCAGG - Exonic
954301875 3:49704630-49704652 CATCTGGGAGGAAGAGCAGGAGG - Exonic
954661088 3:52227274-52227296 CATCTGGCTGGCTCAGCAGCAGG + Intergenic
957188728 3:76978754-76978776 TGTGTGTGTGGAACTGCAGCAGG - Intronic
958965955 3:100558448-100558470 CATCTTTGTGCACCAGCTGCTGG + Exonic
960510596 3:118544607-118544629 CCTGGGTGTGGAGCAGCAGCTGG + Intergenic
962743630 3:138381591-138381613 CATCGGTGGAGAACAGCAGTGGG + Intronic
963730919 3:148971148-148971170 CATCTTTCTGGAACAACATCAGG + Intergenic
966407649 3:179614967-179614989 CCACTGTGTCGAACAGGAGCTGG - Exonic
968765120 4:2464147-2464169 CATCTCTGTAGAATTGCAGCTGG + Intronic
968909459 4:3470131-3470153 CACCTGTGTCTAACAGGAGCTGG - Intronic
969870085 4:10099137-10099159 CATCTGTGGGGCACAGCGGGCGG + Exonic
969895702 4:10302553-10302575 CATCTGTGTGGAAAGGCTCCAGG + Intergenic
970816869 4:20167087-20167109 CCTTGGTGTGAAACAGCAGCTGG - Intergenic
971335873 4:25723727-25723749 GAGCTGTGAGGACCAGCAGCTGG - Intergenic
976688138 4:87838664-87838686 AAGCTGTGTGGAAGAGCAGAGGG + Exonic
977499723 4:97823732-97823754 CATCTGTGTGAAACACCAATTGG + Intronic
979876151 4:125893859-125893881 CATCTGTGTGGAAAACCATAAGG + Intergenic
980113783 4:128659743-128659765 CATCTGTGTGAAATGGCAGCTGG + Intergenic
981220222 4:142223164-142223186 CATATGTGTGGAACAGCCCTGGG - Intronic
982407194 4:155033745-155033767 GATCAGTGTGAAACAGCAGCTGG - Intergenic
983231036 4:165129092-165129114 GATCTGTGTGAAACACCAACAGG + Intronic
986313706 5:6572508-6572530 CTGCTGCGTGAAACAGCAGCCGG + Intergenic
986535926 5:8787012-8787034 CAACTGTGTGGAACAGCATTTGG - Intergenic
988257134 5:28835211-28835233 CATCAGTGTGGGAGAGCTGCAGG - Intergenic
992638757 5:78750498-78750520 CATGTCTGTGGCACAGCAGTTGG - Intronic
993253097 5:85553455-85553477 CATGTGTCTGGAAAAGCTGCAGG - Intergenic
993690761 5:90996690-90996712 CATGTGCCTGGAAAAGCAGCAGG + Intronic
998165809 5:139842898-139842920 CCTCTGAGTTGACCAGCAGCAGG + Exonic
1001797553 5:174514746-174514768 CATCTTTGTGAGACAGCAGCTGG - Intergenic
1002593096 5:180304573-180304595 GAGCTGTGTGGGACAGCTGCGGG + Intronic
1003050357 6:2775237-2775259 CTTCTTTGTGTAAGAGCAGCAGG + Intronic
1003436903 6:6098954-6098976 CATCTTTGTGGAAGACCAGATGG + Intergenic
1004127411 6:12887094-12887116 CAACTGAGTGGAACAGCACATGG - Intronic
1007251341 6:40497222-40497244 CATCTGGGGGGAACTGCAGAGGG - Intronic
1008467596 6:51847910-51847932 AATCTGTGTGCACCAGCAGTAGG + Exonic
1013845404 6:114444786-114444808 CAACTGTCTGGAACAGCACAGGG - Intergenic
1018860363 6:167706836-167706858 CAGCTGTTGAGAACAGCAGCCGG - Intergenic
1019019486 6:168905911-168905933 CATCGGTGTGAAGCAGCAGCTGG - Intergenic
1020002415 7:4763428-4763450 CAACTGGGTGAAAAAGCAGCTGG - Exonic
1020051209 7:5082953-5082975 CTTCTGTTTGGAAAAGCAGAAGG - Intergenic
1021899365 7:25268288-25268310 CATCTGTGTGGAATGGAAGAAGG + Intergenic
1024222534 7:47299738-47299760 CTTCTGTTTGGAAAAACAGCGGG - Intronic
1025024165 7:55502627-55502649 CAGCTCTTTGGAACATCAGCAGG - Intronic
1027339378 7:77189692-77189714 TGTCTGTGTGAAACAGCAGAGGG - Intronic
1027360554 7:77404252-77404274 CATCGGTGTGGGAAAGCAGTAGG - Intronic
1030269733 7:107658225-107658247 CCTCTGTGTGAAACAGGAGAAGG + Intergenic
1031242623 7:119266103-119266125 CATATGCCTGGAAAAGCAGCAGG - Intergenic
1033754215 7:144384671-144384693 CATCTGTGTAGGAAAGGAGCCGG + Intergenic
1033833111 7:145276742-145276764 CATGTGCCTGGAAAAGCAGCAGG + Intergenic
1033970927 7:147038659-147038681 CATTGGTGTGGAAGAACAGCAGG - Intronic
1039657571 8:39426636-39426658 CATCTGTGTGGACCACCAAAGGG + Intergenic
1039908915 8:41808729-41808751 CATCTGTGTGCAGCAGTAGGGGG - Intronic
1041205906 8:55497950-55497972 GCTGAGTGTGGAACAGCAGCGGG - Intronic
1043080644 8:75761017-75761039 CATGTGTCTGGAAAAGCTGCAGG + Intergenic
1046276599 8:111969595-111969617 CATCTCTGTTGAACATCAGTTGG - Intergenic
1046441254 8:114257871-114257893 CAGCTGTGTGGAAGAGCAGTTGG - Intergenic
1046728245 8:117697472-117697494 CATCTTTATGTAACAGGAGCAGG - Intergenic
1046859373 8:119072763-119072785 CATCAGAGTGGAGCAGCAACCGG - Intronic
1046975157 8:120266765-120266787 CATCTGTGGGGAAGAGCGGAAGG - Intronic
1047651725 8:126930201-126930223 TATCTGAGTGGAAATGCAGCTGG + Intergenic
1048162601 8:132034828-132034850 CTTCTTTGGGGAACAGAAGCAGG - Exonic
1049420169 8:142512949-142512971 CTGCTCTGTGGGACAGCAGCGGG + Intronic
1049451876 8:142666356-142666378 CAGCCGTGTGGAGCAGCAGAGGG - Exonic
1050583076 9:7081455-7081477 CGTGTGTGAGGAACAGCAGAGGG + Intergenic
1052193462 9:25684090-25684112 CATCAGTGTGGAAAACCTGCAGG + Intergenic
1052324578 9:27203694-27203716 CATGTGGGTGGAGCTGCAGCAGG + Intronic
1054531246 9:66184741-66184763 CATCTGTGTGAACCTGAAGCGGG + Intergenic
1055971756 9:81918931-81918953 AATCCGTGTGGCACAGCAGCAGG + Intergenic
1055973508 9:81934003-81934025 AATCCGTGTGGCACAGCAGCAGG + Intergenic
1055975262 9:81949095-81949117 AATCCGTGTGGCACAGCAGCAGG + Intergenic
1055980298 9:81994259-81994281 AATCCGTGTGGCACAGAAGCAGG + Exonic
1055987123 9:82063264-82063286 CATCTGTGGGGAAGCGCAGGAGG - Intergenic
1056035864 9:82604754-82604776 CATCAGTTTGGAATAGAAGCAGG + Intergenic
1056559885 9:87720957-87720979 CATCATGGTGGAACAGCAGCGGG + Intergenic
1057115066 9:92513190-92513212 GCTCTGAGTGGAACAACAGCAGG - Intronic
1057931602 9:99198231-99198253 CATCTGAATGGAACAGCAGAGGG + Intergenic
1059405671 9:114097349-114097371 CTTCTATGTGGAGCAGCTGCGGG - Exonic
1060506035 9:124199089-124199111 GGTCTGTGTGGAACAGAGGCTGG - Intergenic
1060794507 9:126504835-126504857 CTCCTGGGTGGCACAGCAGCAGG + Exonic
1062403063 9:136380835-136380857 TATCGATGTGGAACAGCTGCGGG + Exonic
1062521871 9:136961331-136961353 CATCTCTGTGCAACAGCCCCAGG - Intergenic
1203525864 Un_GL000213v1:86003-86025 CCCATGTGTGGGACAGCAGCAGG - Intergenic
1188106749 X:26156077-26156099 CATGTGCCTGGAAAAGCAGCAGG - Intergenic
1188139290 X:26528594-26528616 CATCTTTGTCGAAGATCAGCTGG + Intergenic
1188299203 X:28486790-28486812 CATAGGTGTGGAACAGCAGATGG - Intergenic
1188982718 X:36741747-36741769 CAGCTTTGTTGAACAGCAGATGG + Intergenic
1191204236 X:57817244-57817266 CATGTGGGGGGAACAGCAGTTGG + Intergenic
1191851721 X:65590356-65590378 CTTCTGTGTGGTTCAGCAGAAGG - Intronic
1193883931 X:86961227-86961249 CATCTATGTGTGACAACAGCTGG - Intergenic
1195961402 X:110390899-110390921 CTTCAGTGGTGAACAGCAGCTGG + Intronic
1197385541 X:125796565-125796587 CCTCTGTGTGAAAAAGCTGCAGG + Intergenic
1197473143 X:126887908-126887930 CATCTTTGTCGAACATCAGATGG - Intergenic
1197861279 X:130973474-130973496 CATATGTATGGAACAAAAGCAGG - Intergenic
1198278907 X:135123325-135123347 CATCTGCGTGGAGCATCAGGAGG + Intergenic
1199877096 X:151941901-151941923 CATCTTTGTTGAAGAGCAGATGG + Intergenic
1202030793 Y:20572342-20572364 CATGTGTCTGGAAAAGCTGCAGG - Intergenic