ID: 1072675629

View in Genome Browser
Species Human (GRCh38)
Location 10:97463783-97463805
Sequence GTTGAACAGCACCACCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072675629_1072675634 4 Left 1072675629 10:97463783-97463805 CCCAGAGGGTGGTGCTGTTCAAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1072675634 10:97463810-97463832 GCAGAGGGCAAAGTTCCCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 195
1072675629_1072675635 9 Left 1072675629 10:97463783-97463805 CCCAGAGGGTGGTGCTGTTCAAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1072675635 10:97463815-97463837 GGGCAAAGTTCCCAAAGGCCAGG 0: 1
1: 0
2: 0
3: 18
4: 176
1072675629_1072675640 21 Left 1072675629 10:97463783-97463805 CCCAGAGGGTGGTGCTGTTCAAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1072675640 10:97463827-97463849 CAAAGGCCAGGAAGGAGAGGTGG 0: 1
1: 3
2: 8
3: 127
4: 1003
1072675629_1072675637 18 Left 1072675629 10:97463783-97463805 CCCAGAGGGTGGTGCTGTTCAAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1072675637 10:97463824-97463846 TCCCAAAGGCCAGGAAGGAGAGG 0: 1
1: 0
2: 5
3: 61
4: 515
1072675629_1072675636 13 Left 1072675629 10:97463783-97463805 CCCAGAGGGTGGTGCTGTTCAAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1072675636 10:97463819-97463841 AAAGTTCCCAAAGGCCAGGAAGG 0: 1
1: 0
2: 2
3: 36
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072675629 Original CRISPR GTTGAACAGCACCACCCTCT GGG (reversed) Intronic
905396259 1:37668665-37668687 TTTGGACAGTACCACCATCTTGG + Intergenic
911398623 1:97344911-97344933 GTGAAACAGTACCACCCTTTGGG - Intronic
912167389 1:107057074-107057096 GTTGAACCGCACCACCTCCCGGG - Exonic
912489098 1:110051678-110051700 CTTGAACACCACCAGCATCTGGG - Exonic
914718012 1:150267662-150267684 GTTGGACAGCCCCCTCCTCTAGG - Intronic
916932646 1:169594815-169594837 GATGAACTGCTCCAACCTCTGGG - Exonic
918093033 1:181313866-181313888 GCTGAAGAGAACCACCCACTTGG + Intergenic
922370658 1:224907417-224907439 GTTGGAAAGCCCCACACTCTGGG + Intronic
1065842025 10:29710015-29710037 ATTGAGCAGCCCCTCCCTCTAGG - Intronic
1072675629 10:97463783-97463805 GTTGAACAGCACCACCCTCTGGG - Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1075932551 10:126311727-126311749 GTTGCAGTGCACCACCCTCCTGG - Intronic
1077017411 11:403154-403176 GTTGTACAGCCCCACGATCTGGG - Exonic
1080137273 11:28870511-28870533 AATGAACAGCACCACCATCACGG + Intergenic
1085238376 11:75032382-75032404 CTAGAACGGCACCACCCTTTGGG + Intergenic
1085997171 11:81932913-81932935 ATTGAACAGCATCAACCTATTGG + Intergenic
1092947404 12:13469634-13469656 CTTGGGCAGGACCACCCTCTGGG - Intergenic
1094052613 12:26237834-26237856 TTTGGACAGCACCTCTCTCTAGG + Intronic
1094627695 12:32140178-32140200 GTTTAACAGCAGGATCCTCTGGG + Intronic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1102231655 12:111266727-111266749 GTAGAAAAGCACCACCAACTGGG - Intronic
1106790922 13:33154112-33154134 GTTGAAAGGCCCCACCCTCATGG - Intronic
1115440492 14:33429325-33429347 GTTAAACACCACCACCATCCTGG - Intronic
1116293409 14:43073180-43073202 TTTCAACAGCACCGCACTCTTGG - Intergenic
1117095355 14:52291682-52291704 CTTGAATAGCACCACACTGTTGG + Intergenic
1118701637 14:68439282-68439304 GTTGGGCAGCTCCAGCCTCTGGG + Intronic
1118843634 14:69529852-69529874 GTGGAAGACCACCACCCTCCAGG + Exonic
1122466599 14:101938085-101938107 CCTGGACAGCATCACCCTCTGGG + Intergenic
1124707027 15:31974683-31974705 GTTCAACAGCTTCACCCACTGGG + Intergenic
1127682302 15:61309796-61309818 GCTGTCCAGCACCACCCTCCAGG + Intergenic
1129906450 15:79191010-79191032 GTTGACCTGCACCTCTCTCTTGG + Intergenic
1132692588 16:1188270-1188292 GTTGTCCAGGACCACCCTTTGGG + Intronic
1133478713 16:6148511-6148533 GTTGAATCTCACCACCCTCAAGG + Intronic
1135198515 16:20415706-20415728 GTTGCTCAGCTCCACCCTCTGGG - Intronic
1136146622 16:28320176-28320198 GTCGAACAGCAGCACGTTCTCGG - Exonic
1139342235 16:66275123-66275145 ATGGTGCAGCACCACCCTCTTGG + Intergenic
1141684898 16:85564626-85564648 GTTGCTCAGCAGCACCCTCTAGG + Intergenic
1142407857 16:89901146-89901168 GGTGCAGAGCACAACCCTCTCGG - Intronic
1142903295 17:3026607-3026629 GTTGGCCATCACCACCCCCTGGG + Intronic
1147323721 17:39660483-39660505 GTTCCACAGCACCATCCTCTCGG - Exonic
1151052576 17:70995446-70995468 GTTGTCCAGCACCTGCCTCTGGG - Intergenic
1151292903 17:73163347-73163369 GTAGAACAGCAGCATCATCTCGG + Intergenic
1152740003 17:82014661-82014683 CGAGAACAGCACCACCCTCCGGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156839803 18:41598006-41598028 CTAAAACAGCACCTCCCTCTAGG + Intergenic
1158259326 18:55589913-55589935 GTCGACCAGCACCGCCATCTTGG - Intronic
1161601501 19:5186686-5186708 GTTGAACAGCATCAGCCATTAGG - Intronic
1161754251 19:6120096-6120118 GTTGAACAGCAACTCCCTATGGG + Intronic
925335364 2:3095252-3095274 GCTGAACAACAGCAGCCTCTAGG + Intergenic
925421007 2:3711880-3711902 GATGCCCAACACCACCCTCTGGG + Intronic
929033365 2:37669749-37669771 ATAAAACAGCACCAGCCTCTGGG - Intronic
929727947 2:44451423-44451445 GTAGAAGAACACCAGCCTCTTGG - Intronic
930009239 2:46923088-46923110 GTTGGAGTGCACCACCCTCCTGG + Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
934548001 2:95234685-95234707 GTTGGAGTGCTCCACCCTCTGGG - Intronic
935381836 2:102460649-102460671 GTGCAACAGCACCATCCACTGGG + Intergenic
937263158 2:120599190-120599212 TTTGAACAGCAGCAACTTCTGGG + Intergenic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
945995102 2:216429996-216430018 GTTGCCCAGCCCCACCCCCTGGG + Intronic
946804469 2:223457423-223457445 GTTGTACTTCTCCACCCTCTTGG + Intergenic
947712884 2:232325968-232325990 GTTGAGCCGCTCCACACTCTGGG - Intronic
948564511 2:238875359-238875381 CTCCAACAGCACCACCCACTGGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1172319635 20:33986277-33986299 GTGGAACAGGACTACCCCCTAGG - Intergenic
1172934675 20:38611331-38611353 ATTGAACAGATCCACTCTCTTGG - Intronic
1173299283 20:41786775-41786797 GTTAACCATAACCACCCTCTGGG + Intergenic
1180901755 22:19378026-19378048 CTTTAACAGCATCCCCCTCTCGG - Exonic
952375609 3:32764727-32764749 GTTGAACAGCATCACAGTCCTGG - Exonic
953408180 3:42670602-42670624 GTGGAACAGCGCTACCCTATAGG + Intergenic
956339576 3:68206986-68207008 GTTGAATTACACCACCTTCTTGG - Intronic
957335206 3:78818744-78818766 GTTGAACAGGACGACCATCCCGG - Intronic
960602444 3:119471252-119471274 GTGGAATGGCACCACTCTCTTGG + Intronic
960863920 3:122181403-122181425 GAGGAACAGCCCCACCATCTTGG + Intergenic
961726257 3:128932960-128932982 CTATAACAGCACCACCCTCTGGG - Exonic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
970420075 4:15897840-15897862 GTTGAGGTGCACCATCCTCTTGG + Intergenic
972835491 4:42865513-42865535 GATGAACAGAACCAGCGTCTTGG + Intergenic
978969068 4:114780532-114780554 GTTCAATAGCACCACACTATAGG - Intergenic
979520131 4:121656359-121656381 TGTCAACAGCACCACCCTCTGGG + Intergenic
982679382 4:158410608-158410630 GTTGACCAACATCAGCCTCTGGG - Intronic
983006447 4:162490753-162490775 CTTGAGCAGCTCCACCCTTTTGG - Intergenic
984888428 4:184472284-184472306 GTTAAACAGAGTCACCCTCTGGG + Intronic
986007669 5:3681692-3681714 TGTGGACAGCATCACCCTCTGGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
994953623 5:106498396-106498418 GTTGAACAGCAGCAACCACTGGG + Intergenic
998637380 5:143971306-143971328 TTTGCCCAACACCACCCTCTTGG - Intergenic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000793493 5:165635235-165635257 GTTGTACTGCATCACACTCTGGG - Intergenic
1001534310 5:172488140-172488162 TTTGAACAGCCCCCCCCTCCAGG + Intergenic
1002587880 5:180263533-180263555 GGTGAACACCACAAGCCTCTAGG - Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1018798140 6:167203009-167203031 GTTGAACAGGTAAACCCTCTGGG + Intergenic
1018814575 6:167321167-167321189 GTTGAACAGGTAAACCCTCTGGG - Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1025951470 7:66148742-66148764 CCTGAACAGCACTACCATCTAGG + Intronic
1028754561 7:94420534-94420556 GTTGACCAGCAGCACCCTGTTGG - Exonic
1031111293 7:117612710-117612732 GTCGAATGGCACCACCTTCTCGG - Intronic
1033151034 7:138915293-138915315 GTGGTTCAGTACCACCCTCTAGG + Intronic
1033598714 7:142874229-142874251 GTCTCACAGCTCCACCCTCTGGG + Intronic
1035731843 8:1859165-1859187 TGTGCACAGCACCAGCCTCTCGG + Intronic
1044663720 8:94615377-94615399 ATTGAACAGCGCCACCATCCAGG - Intergenic
1047545714 8:125814139-125814161 CTTGGACAGCTCCACCCCCTTGG - Intergenic
1049571189 8:143371003-143371025 GCTGGACAGGAGCACCCTCTGGG + Intronic
1053394337 9:37759003-37759025 GTTCCACAGCACCACCATCTGGG - Intronic
1056637571 9:88344370-88344392 ATGGATCAGAACCACCCTCTTGG + Intergenic
1059142876 9:111870650-111870672 GTTGAGGTGCACCACCCTCCTGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1203780585 EBV:98489-98511 GTTGAGTAGCAACACCCCCTGGG - Intergenic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1187157565 X:16735068-16735090 GATGAAAAGCACCACTTTCTTGG - Intronic
1187526823 X:20061695-20061717 GTAGAACAGCTCCCCCTTCTTGG - Intronic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1195010740 X:100730766-100730788 GTAGAAAAGCACCACCAACTTGG - Intronic
1196396784 X:115272259-115272281 GTTGGACTGGACCACCCTCAAGG + Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1198636685 X:138710121-138710143 GTTCAAAAGCACCACAGTCTGGG + Intronic
1202188255 Y:22212489-22212511 GGTGAAGACCACCACCTTCTTGG + Intergenic