ID: 1072678525

View in Genome Browser
Species Human (GRCh38)
Location 10:97487804-97487826
Sequence AAAGGGCAACAATTTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072678519_1072678525 12 Left 1072678519 10:97487769-97487791 CCGATATATAAAGAGTTCCCACA 0: 1
1: 0
2: 2
3: 18
4: 173
Right 1072678525 10:97487804-97487826 AAAGGGCAACAATTTAAAATGGG No data
1072678518_1072678525 13 Left 1072678518 10:97487768-97487790 CCCGATATATAAAGAGTTCCCAC 0: 1
1: 0
2: 2
3: 21
4: 188
Right 1072678525 10:97487804-97487826 AAAGGGCAACAATTTAAAATGGG No data
1072678517_1072678525 20 Left 1072678517 10:97487761-97487783 CCAGTTTCCCGATATATAAAGAG 0: 1
1: 0
2: 0
3: 5
4: 160
Right 1072678525 10:97487804-97487826 AAAGGGCAACAATTTAAAATGGG No data
1072678520_1072678525 -5 Left 1072678520 10:97487786-97487808 CCCACAAATCAATGCAGAAAAGG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 1072678525 10:97487804-97487826 AAAGGGCAACAATTTAAAATGGG No data
1072678522_1072678525 -6 Left 1072678522 10:97487787-97487809 CCACAAATCAATGCAGAAAAGGG 0: 1
1: 0
2: 4
3: 20
4: 251
Right 1072678525 10:97487804-97487826 AAAGGGCAACAATTTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072678525 Original CRISPR AAAGGGCAACAATTTAAAAT GGG Intronic
No off target data available for this crispr