ID: 1072686220

View in Genome Browser
Species Human (GRCh38)
Location 10:97538950-97538972
Sequence GGAGCCACTCATCTGTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072686220_1072686224 5 Left 1072686220 10:97538950-97538972 CCATGTTACAGATGAGTGGCTCC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1072686224 10:97538978-97539000 GAAGACCTGCGCAGATCACATGG No data
1072686220_1072686228 25 Left 1072686220 10:97538950-97538972 CCATGTTACAGATGAGTGGCTCC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1072686228 10:97538998-97539020 TGGTGCATTAGGGCCATGCCTGG No data
1072686220_1072686226 14 Left 1072686220 10:97538950-97538972 CCATGTTACAGATGAGTGGCTCC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1072686226 10:97538987-97539009 CGCAGATCACATGGTGCATTAGG No data
1072686220_1072686227 15 Left 1072686220 10:97538950-97538972 CCATGTTACAGATGAGTGGCTCC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1072686227 10:97538988-97539010 GCAGATCACATGGTGCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072686220 Original CRISPR GGAGCCACTCATCTGTAACA TGG (reversed) Intronic
900282231 1:1878094-1878116 AGATCCAGTCATCTGTAAGATGG + Intronic
902139531 1:14341249-14341271 TTAGGCACTCATCTGTAAAATGG + Intergenic
903483456 1:23671363-23671385 CATGTCACTCATCTGTAACATGG - Intergenic
904635823 1:31880301-31880323 TGAGCCACTGATCTTCAACAAGG + Intergenic
907370690 1:54001177-54001199 GGAGCCACTCTACTGTAGCCTGG + Intergenic
910534330 1:88279283-88279305 GGAGCAACTCATGTCTTACATGG + Intergenic
917600767 1:176571382-176571404 GAAGTCCCTCATCTGTAAAATGG + Intronic
918115120 1:181489570-181489592 GGGGGCACTCAAATGTAACAGGG - Intronic
918602596 1:186381291-186381313 TGAGACACTCATTTGTAAGATGG - Intronic
920841879 1:209562095-209562117 AGAGCCACTCCTTTGTAGCAGGG - Intergenic
920938112 1:210455003-210455025 GGAGCCAGTGATCTGTAGAAAGG - Intronic
1065455015 10:25898296-25898318 GGGGCCAGGCATGTGTAACATGG + Intergenic
1065524652 10:26607529-26607551 GGAGGCCCTCATCCGTAACTGGG + Intergenic
1067225415 10:44373030-44373052 GGAGCCACTCCTCTGACTCAGGG - Intronic
1067819299 10:49513172-49513194 GTATCCACTCACCTGTAAGATGG - Intronic
1068005375 10:51387119-51387141 GCAGCCAATCATCTGGCACAAGG + Intronic
1068141500 10:53014137-53014159 GGAGCCATTCTTTTTTAACAGGG - Intergenic
1070194052 10:74140117-74140139 GGAGCCACTCTGCTGTTCCAAGG + Intronic
1071993477 10:91124183-91124205 GGAGCTACTCGTCTATCACAGGG + Intergenic
1072686220 10:97538950-97538972 GGAGCCACTCATCTGTAACATGG - Intronic
1076187209 10:128459206-128459228 AGAGCCCCTCATTTGGAACAGGG + Intergenic
1080778086 11:35404645-35404667 GGAGCCACACCTCTGAACCATGG - Intronic
1080965030 11:37204503-37204525 AGATCCTGTCATCTGTAACAAGG - Intergenic
1081430695 11:42973560-42973582 CAATCTACTCATCTGTAACATGG - Intergenic
1085533686 11:77205928-77205950 TGAGCTCCTCATCTGTAAAATGG - Intronic
1086850209 11:91799554-91799576 GGAGCCAGTCATATCTTACATGG + Intergenic
1088629464 11:111760694-111760716 TCAGCCACTCATTGGTAACAAGG + Intronic
1089728218 11:120501888-120501910 GGAGAGACACATCTGAAACAAGG + Intergenic
1089728997 11:120508842-120508864 GGAGTCACTCCTCTGTCACCAGG - Intergenic
1091279338 11:134373202-134373224 GGAGCCACTCATCAGTGTCCCGG - Intronic
1096985472 12:55753329-55753351 TTAGCCACTCTTGTGTAACAAGG - Exonic
1097305969 12:58069233-58069255 GGAGCAAGTCATCTTTTACATGG - Intergenic
1104093613 12:125536505-125536527 GGTGCATCTCATCTGTAATATGG + Intronic
1109987721 13:70011946-70011968 GGAGCCAGTCATGTCTTACATGG + Intronic
1114466589 14:22927508-22927530 GGAGCCCCTCAGCTATACCATGG + Exonic
1117290336 14:54326180-54326202 GGAGACACTCATCTGGAAGCTGG + Intergenic
1120792723 14:88599896-88599918 GCAAACAGTCATCTGTAACATGG + Intronic
1127402796 15:58607162-58607184 AGAACCACTCATCTAGAACAGGG - Intronic
1129385057 15:75191846-75191868 TGAGCCACTCCACTGTGACACGG + Intergenic
1130207364 15:81889650-81889672 GAAGCCACTCAGCTGTACAAGGG - Intergenic
1131594540 15:93783767-93783789 GGAAGCACTCATCTGCAAAATGG - Intergenic
1131720609 15:95164646-95164668 GGAGCAACTCCTTTGTAAAACGG + Intergenic
1133746525 16:8691252-8691274 ATAGCCCCTCATCTGTAAAATGG - Intronic
1134212717 16:12291301-12291323 GGAGCAAGTCATGTCTAACATGG + Intronic
1140217002 16:73016794-73016816 GGAGCCACTCTGCTGTCACCAGG - Intronic
1140258517 16:73357534-73357556 GAAGTAGCTCATCTGTAACAGGG - Intergenic
1140363533 16:74364349-74364371 TGAACTCCTCATCTGTAACACGG + Intergenic
1141187534 16:81798552-81798574 GGGGCCACTCCACTGTCACAGGG + Intronic
1142545855 17:702308-702330 GGAGCCACTGAACTGTAGCCTGG + Intronic
1144778262 17:17795630-17795652 GGCCCCACTCATCTGCACCAAGG + Exonic
1146253424 17:31371945-31371967 GGAGCCACTCATCTTTCATTTGG - Intronic
1147020110 17:37524664-37524686 GCAGTCAGTCATCTGTAAAATGG + Intronic
1148808908 17:50278319-50278341 CACGCCCCTCATCTGTAACACGG - Intronic
1149866696 17:60155026-60155048 GAGGCCACTCATCTCTAACATGG - Intronic
1151692464 17:75695049-75695071 GGAGGGAATCACCTGTAACACGG - Intronic
1160006815 18:75074305-75074327 TGTCCCACTCATCTGTAAAATGG - Intergenic
1160657350 19:280431-280453 GGGGCCACACTTCTGAAACAGGG - Intergenic
1166635395 19:44447071-44447093 TTAGCAACTCATCTGTGACATGG + Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
926760604 2:16275514-16275536 GGAGCCAATCTTCTCTAGCAGGG + Intergenic
928114837 2:28539197-28539219 TGAGACACGCATCTGTGACACGG + Intronic
932421893 2:71606082-71606104 GGAGCGACTCCTGTCTAACATGG + Intronic
935141914 2:100360864-100360886 GGGGCCACACATGTTTAACATGG - Intergenic
939956960 2:148535240-148535262 GGACTTCCTCATCTGTAACATGG + Intergenic
940021856 2:149164385-149164407 GGAGCCACATATCTGGACCATGG + Intronic
943554510 2:189385983-189386005 GGAGCAACTCATGTCTTACATGG + Intergenic
947955529 2:234187147-234187169 GGAGCCAGTCATGTCTTACATGG - Intergenic
1169150169 20:3283311-3283333 CGAACAACTCATCTGTAAAAAGG + Intronic
1169399518 20:5268055-5268077 TGAGGCACTCATGTGAAACAAGG + Intergenic
1170809279 20:19661058-19661080 GGAGCCTTTCATCTCTAACAAGG + Intronic
1172238472 20:33395037-33395059 GTAGCCACTCTTCTGTAAGATGG + Exonic
1173683392 20:44904154-44904176 GGAGCCAGTCTTCTTTCACAGGG + Intronic
1175632912 20:60557140-60557162 GGAGCCTCCCTTGTGTAACAGGG + Intergenic
1175699392 20:61125992-61126014 GGAGCCACTCATCTGAGCCCAGG - Intergenic
1177807060 21:25884932-25884954 GGAGCCTCGCATCTCTAGCAGGG - Intronic
1180257751 21:46644604-46644626 GTAGCCACTCAGCTCTGACATGG + Intronic
1180855698 22:19043439-19043461 CCAGCCACACATCTATAACATGG + Intronic
1182462285 22:30491427-30491449 GGGGCCACTCATCTGATCCATGG + Intronic
950219889 3:11186401-11186423 GGATCCACTCATCTGATACTGGG - Intronic
955326019 3:58009654-58009676 GGACCCCCTTATCTGTAAAATGG - Intronic
955435339 3:58893938-58893960 GGAGCAAGTCACCTGTTACATGG + Intronic
957692347 3:83588463-83588485 GGAGCCAATCTTCTTTAGCATGG - Intergenic
958535559 3:95398548-95398570 GGAGCCACACTTTTGTAACCAGG + Intergenic
958535562 3:95398569-95398591 GGAGCCACACTTTTGTAACCAGG + Intergenic
958659527 3:97048442-97048464 GAAGCCCCAAATCTGTAACAAGG - Intronic
959474190 3:106789540-106789562 GTATCCACTTATCTGTAGCAAGG + Intergenic
960266687 3:115628171-115628193 GAAGGAACTCATCTCTAACAGGG - Intronic
966420854 3:179732896-179732918 GGAGCCACTGCTCTGGATCAAGG + Intronic
969501881 4:7558482-7558504 GGCCCCACTCTCCTGTAACAGGG + Intronic
974999753 4:69208125-69208147 GGAGCCACTCATGAATACCAAGG + Intronic
975015682 4:69415420-69415442 GGAACCACTCATGCATAACAAGG - Intronic
976563895 4:86531849-86531871 GGAGCCACTCATCTCCAAACTGG + Intronic
976747583 4:88419425-88419447 TCAGACACTCATCTGTAACATGG - Intronic
977292955 4:95182885-95182907 GGAGCCACTTACCTCTGACACGG + Exonic
978820793 4:112962857-112962879 GGAGCCATTCAGCTGTATAAGGG + Intronic
982851247 4:160318702-160318724 GGAGCCACTCAACTTTGAGAAGG - Intergenic
984333420 4:178356647-178356669 AGAGCCACTGATATGTAACGAGG - Intergenic
984916660 4:184731354-184731376 GCAAGCACACATCTGTAACATGG - Intronic
987783043 5:22464176-22464198 GGAGCCAGTCACCTCTTACATGG - Intronic
989228843 5:39064205-39064227 GGAGCCATTCAACTTTAACCTGG + Intronic
991179067 5:63727653-63727675 GGTGCCACCCATATATAACAGGG - Intergenic
995333951 5:110977287-110977309 GGAGCAAGTCATGTCTAACATGG + Intergenic
996994786 5:129682341-129682363 TGTGCCCCTCAACTGTAACATGG + Intronic
997454584 5:134007267-134007289 GTAGGCACTCATCAGTAACTGGG + Intergenic
999069715 5:148730934-148730956 GGGGCTACTCATTTGTAAAAGGG - Intergenic
1000118728 5:158176803-158176825 TCAGCAACTCATCTGTAAAATGG + Intergenic
1003301100 6:4883531-4883553 GGTGGCACTCATCTGTGCCATGG - Intronic
1006435826 6:34025788-34025810 AGAGTCTCTCATCTGTAAGATGG + Intronic
1007910218 6:45505944-45505966 GGAACCAGTCATCTGTCATAAGG - Intronic
1014670616 6:124300317-124300339 GGAGCAAGTCATGTGTTACATGG - Intronic
1016780263 6:147950409-147950431 GGACCCACTCAGCTGCATCAAGG + Intergenic
1021624901 7:22583457-22583479 TCAGCCACTCCTCTGTAAGAAGG + Intronic
1021896841 7:25244459-25244481 GGAGCCAATCCTCTGTAGCAGGG + Intergenic
1022964142 7:35457195-35457217 GGAGCAACTCATGTCTTACATGG + Intergenic
1028243188 7:88445971-88445993 AGAGCCACTCATCTACACCAGGG - Intergenic
1029247614 7:99214095-99214117 GCAGCCAATAATCTGTAACAAGG + Intergenic
1033528737 7:142242962-142242984 AGCTCCATTCATCTGTAACAGGG + Intergenic
1034284024 7:149872988-149873010 GAGGCCACTGATCTGTAAAAGGG + Exonic
1037298635 8:17427969-17427991 GGAGCCAGTCATGTCTTACATGG + Intergenic
1047167829 8:122460096-122460118 GGAACAACTCATTTGTGACATGG + Intergenic
1047993802 8:130314423-130314445 GTTCCCTCTCATCTGTAACATGG - Intronic
1048016084 8:130498958-130498980 GGAGCCAACCCTCTGAAACATGG - Intergenic
1048134954 8:131739590-131739612 TCAGCTACTCATCTGTATCAGGG + Intergenic
1048889610 8:138935946-138935968 GGCGCCTGTCATCTGTCACATGG - Intergenic
1049448812 8:142647576-142647598 GGAGCAAGTCATGTGTGACATGG - Intergenic
1052020339 9:23518519-23518541 GGAGCAAGTCATCTCTTACATGG - Intergenic
1052266414 9:26578906-26578928 GGAGACAGACATCTGTAAAAAGG + Intergenic
1052411105 9:28122580-28122602 AGAGCGACTCTTCTGTAACATGG - Intronic
1052486641 9:29109957-29109979 GTATCTTCTCATCTGTAACAAGG - Intergenic
1053447758 9:38166094-38166116 AGAGCCAGTGATCTGGAACAGGG - Intergenic
1055127823 9:72739171-72739193 GGAGCCAGCCATCTGCAACCTGG - Intronic
1057902607 9:98961376-98961398 GGACACTCTCATCTGTACCAGGG + Intronic
1061023314 9:128031099-128031121 GGAGCCACTCACCTGTGGCTGGG + Intergenic
1061322076 9:129837025-129837047 GGAGCAGCTCATCTGTACCCTGG - Intronic
1062412819 9:136433469-136433491 GGAGCCACTCAAGTGGAACTGGG - Intronic
1186816925 X:13247102-13247124 TGAGCTCCTCATCTGTAAAATGG - Intergenic
1187476359 X:19614459-19614481 AGAGCCACTCATCTAGTACATGG - Intronic
1187665891 X:21609060-21609082 GGCGCAACTCATCTGTAGAAAGG - Exonic
1192624092 X:72710091-72710113 GGAACCACTCATCTAGATCAGGG + Intronic
1193796801 X:85887356-85887378 GGAGCAAGTCATGTGTTACATGG - Intronic
1195574639 X:106436281-106436303 GGAGCCACTCAACTGCTCCATGG + Intergenic
1199971661 X:152866187-152866209 GGTGCCACTCATGAGGAACAGGG - Intronic