ID: 1072687086

View in Genome Browser
Species Human (GRCh38)
Location 10:97543947-97543969
Sequence CTGTTAAGTTAGTTGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072687083_1072687086 4 Left 1072687083 10:97543920-97543942 CCTGGTGCTGGATGGGCCACATC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1072687086 10:97543947-97543969 CTGTTAAGTTAGTTGAAACAAGG No data
1072687080_1072687086 13 Left 1072687080 10:97543911-97543933 CCGGTGGGGCCTGGTGCTGGATG 0: 1
1: 0
2: 0
3: 49
4: 289
Right 1072687086 10:97543947-97543969 CTGTTAAGTTAGTTGAAACAAGG No data
1072687079_1072687086 14 Left 1072687079 10:97543910-97543932 CCCGGTGGGGCCTGGTGCTGGAT 0: 1
1: 0
2: 1
3: 28
4: 216
Right 1072687086 10:97543947-97543969 CTGTTAAGTTAGTTGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072687086 Original CRISPR CTGTTAAGTTAGTTGAAACA AGG Intronic
No off target data available for this crispr