ID: 1072690976

View in Genome Browser
Species Human (GRCh38)
Location 10:97572295-97572317
Sequence GACCCTCCTCACAGCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 356}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072690973_1072690976 0 Left 1072690973 10:97572272-97572294 CCTGGCCTGGACAAGTAGAGTGT No data
Right 1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG 0: 1
1: 0
2: 2
3: 30
4: 356
1072690971_1072690976 7 Left 1072690971 10:97572265-97572287 CCACGGCCCTGGCCTGGACAAGT No data
Right 1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG 0: 1
1: 0
2: 2
3: 30
4: 356
1072690967_1072690976 18 Left 1072690967 10:97572254-97572276 CCTTCCTGCTACCACGGCCCTGG No data
Right 1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG 0: 1
1: 0
2: 2
3: 30
4: 356
1072690966_1072690976 19 Left 1072690966 10:97572253-97572275 CCCTTCCTGCTACCACGGCCCTG No data
Right 1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG 0: 1
1: 0
2: 2
3: 30
4: 356
1072690974_1072690976 -5 Left 1072690974 10:97572277-97572299 CCTGGACAAGTAGAGTGTGACCC 0: 1
1: 0
2: 2
3: 25
4: 357
Right 1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG 0: 1
1: 0
2: 2
3: 30
4: 356
1072690972_1072690976 1 Left 1072690972 10:97572271-97572293 CCCTGGCCTGGACAAGTAGAGTG No data
Right 1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG 0: 1
1: 0
2: 2
3: 30
4: 356
1072690969_1072690976 14 Left 1072690969 10:97572258-97572280 CCTGCTACCACGGCCCTGGCCTG No data
Right 1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG 0: 1
1: 0
2: 2
3: 30
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072690976 Original CRISPR GACCCTCCTCACAGCCAGCA GGG Intergenic
900390701 1:2432627-2432649 GACCCTCATCATGCCCAGCAGGG - Intronic
900640880 1:3687586-3687608 GAGCATCCTGAGAGCCAGCAAGG - Intronic
900807690 1:4778511-4778533 CACCCTCTACAAAGCCAGCATGG + Intronic
900994888 1:6115617-6115639 GACCCAGCTGACAGCCAGCAAGG + Intronic
901156717 1:7145130-7145152 GGCCCTTCTCAAAGCCATCATGG + Intronic
901494648 1:9614031-9614053 GCCCCTCCTCAGTGCCAGGAAGG - Exonic
901812285 1:11774720-11774742 GCCCCTCCCCACAGCCAACCAGG - Intronic
902227585 1:15006438-15006460 GTCCCTCCTGACAGCGAGCCGGG + Intronic
902257431 1:15199084-15199106 GACTTTCTTCACAGCCAGCATGG - Intronic
903531241 1:24032218-24032240 GACGCTCCTCACATCCCGGACGG + Intergenic
903620453 1:24694333-24694355 GATCCTCCCAGCAGCCAGCAAGG + Intergenic
903698593 1:25229181-25229203 GACCCTCCTCAAAGAAGGCAAGG - Intronic
903809696 1:26028529-26028551 CAGCCTCCTCAGAGCCAGCCTGG - Intronic
904617327 1:31756841-31756863 GGCCCCCAGCACAGCCAGCATGG + Intronic
904913582 1:33953638-33953660 GACCCTCCTCCCAGGAAGAAAGG + Intronic
905427321 1:37896168-37896190 GACGCTCCTCACATCCCGGACGG - Intronic
905466699 1:38159811-38159833 TACTCTCCACACAGCCACCAAGG - Intergenic
905686656 1:39913356-39913378 GACGCTCCTCACATCCCGGACGG + Intergenic
907462752 1:54615006-54615028 GGCCTTCCTCACACCCTGCAGGG - Intronic
909579565 1:77219176-77219198 TACCCTCCTCAAACCCAGCCTGG + Intronic
909731727 1:78900177-78900199 GCCCCGTCTCACAGCCAGCAAGG + Intronic
910211264 1:84795868-84795890 CTGCTTCCTCACAGCCAGCAAGG + Intergenic
912371504 1:109177397-109177419 GACGCTCCTCACATCCTGGACGG + Intronic
912388010 1:109282179-109282201 GCCACATCTCACAGCCAGCATGG - Intronic
912710847 1:111948712-111948734 AGCCCTCCTCACTGCCAGGAGGG + Intronic
913233741 1:116763066-116763088 GCCCCTCGTCCAAGCCAGCAGGG + Intronic
913251485 1:116915332-116915354 GCCCGTCCTCAGAGCCGGCATGG - Intronic
915208363 1:154287575-154287597 GACGCTCCTCACATCCCGGACGG - Intergenic
915287555 1:154862587-154862609 TACCCTCCTCACAACCTGCCCGG + Intronic
915627827 1:157126737-157126759 GCCCCTCCGCACAGTCAGCCAGG - Intronic
915627833 1:157126768-157126790 GTCCCTCCGCACAGTCAGCCAGG - Intronic
915627856 1:157126861-157126883 GTCCCTCCCCACAGTCAGCCAGG - Intronic
915627865 1:157126892-157126914 GCCCCTCCCCACAGTCAGCCAGG - Intronic
915627873 1:157126923-157126945 GTCCCTCCCCACAGTCAGCCAGG - Intronic
915627881 1:157126954-157126976 GTCCCTCCCCACAGTCAGCCAGG - Intronic
915627890 1:157126985-157127007 GCCCCTCCCCACAGTCAGCCAGG - Intronic
915627899 1:157127016-157127038 GCCCCTCCCCACAGTCAGCCAGG - Intronic
916104784 1:161422982-161423004 GACGCTCCTCACATCCCGGACGG - Intergenic
916208964 1:162343076-162343098 GCTCTTCCTCACAGCCTGCATGG + Intronic
917583173 1:176396943-176396965 GACGCTCCTCACATCCTGGACGG + Intergenic
917810756 1:178656250-178656272 CCACCTCCTCTCAGCCAGCAAGG + Intergenic
918255367 1:182742042-182742064 GACGCTCCTCACATCCCGGACGG + Intergenic
919079955 1:192857000-192857022 GACGCTCCTCACATCCCGGACGG - Intergenic
920152512 1:203920057-203920079 GACGCTCCTCACATCCTGGACGG + Intergenic
920249982 1:204617108-204617130 GACTCTCCTCAGAGCCTGGAGGG - Intergenic
920372131 1:205485648-205485670 CACCCTCCTGGCCGCCAGCAGGG + Intergenic
921129255 1:212205891-212205913 CACCCTACTCACAGCCAACCAGG + Intergenic
921280337 1:213560462-213560484 GACCCTGCTGACAGCCAGTAAGG + Intergenic
922503883 1:226115307-226115329 GACGCTCCTCACATCCCGGACGG + Intergenic
923267963 1:232331957-232331979 GACGCTCCTCACATCCCGGACGG - Intergenic
923550423 1:234958952-234958974 GACCCTCCTCCCAGACAGCCGGG + Intergenic
1063141849 10:3262872-3262894 AATCCTCCTCACAGCTAGGAAGG + Intergenic
1063364087 10:5479400-5479422 GACCCTTCTCAGAGCCAGAGAGG - Intergenic
1063448459 10:6134971-6134993 GACCCCGCTGACAGCCAGCGAGG + Intergenic
1065255997 10:23868516-23868538 GACTCTCCTGACAGTCAGCCTGG + Intronic
1066701622 10:38135721-38135743 GCACCTCCTCACAGGCGGCAGGG + Intergenic
1067406666 10:46030194-46030216 GACCCTCCTCACACCCGGCTCGG - Intronic
1067564988 10:47330012-47330034 GGCCCTCCTCAGAGCCAGAGAGG - Intergenic
1067729158 10:48796707-48796729 AACCCTCATGACAGCCTGCAAGG - Intronic
1069365619 10:67691547-67691569 GACGCTCCTCACATCCCGGACGG - Intronic
1069793724 10:71039645-71039667 CACCATCCTGGCAGCCAGCATGG + Intergenic
1070089170 10:73267865-73267887 GCCCCTGCTGAGAGCCAGCAAGG - Intronic
1070135425 10:73689643-73689665 GACGCTCCTCACATCCTGGACGG - Intronic
1070336107 10:75456305-75456327 GTGCCTCTTCACACCCAGCAAGG + Intronic
1070668290 10:78360719-78360741 TACCCTTCTCCCAGCCAGGAGGG - Intergenic
1071781534 10:88851684-88851706 GACTTTCCTCTCAGCCAGGAAGG - Exonic
1071983193 10:91024249-91024271 GTGCAGCCTCACAGCCAGCAAGG - Intergenic
1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG + Intergenic
1073055703 10:100699607-100699629 CCCCCACCTGACAGCCAGCAAGG + Intergenic
1074587978 10:114787150-114787172 GACGCTCCTCACATCCCGGACGG - Intergenic
1075407327 10:122203538-122203560 GACGCTCCTCACATCCCGGATGG + Intronic
1075464499 10:122641573-122641595 TCCCCTCCTCTCAGCCACCAAGG - Intronic
1075545305 10:123350668-123350690 CTTCCTCCTCCCAGCCAGCATGG - Intergenic
1075874116 10:125792486-125792508 TACCCACCTCACAGGCTGCAAGG + Intronic
1076150904 10:128161321-128161343 GCCGCTGCTCAGAGCCAGCAGGG - Intergenic
1076250642 10:128981344-128981366 GAAGCTCCTCACAGCCACCTTGG - Intergenic
1076362189 10:129897193-129897215 GGCCCTCCACGCAGCCAGGAAGG + Intronic
1076613060 10:131738227-131738249 GACCCTCCTCCCAGCCTTGAAGG - Intergenic
1076844306 10:133061532-133061554 CCCCCTCCTCACAGACAGCAAGG + Intergenic
1077286453 11:1768088-1768110 GACTCTCCACACAGCCAGGAGGG - Intergenic
1078487817 11:11740229-11740251 AACCCTCCACACAGCTAGCCTGG - Intergenic
1079109354 11:17595746-17595768 TTGCTTCCTCACAGCCAGCAAGG + Intronic
1079372043 11:19860371-19860393 GACGCTCCTCACATCCCGGACGG + Intronic
1080606464 11:33869072-33869094 GACGCTCCCCAAAGCCACCACGG - Intronic
1081705664 11:45180871-45180893 CCCCCTCCTCCGAGCCAGCAGGG - Intronic
1081759020 11:45564146-45564168 GCCCCTGCTGACAGCCAGCGAGG - Intergenic
1081950485 11:47038882-47038904 GACGCTCCTCACATCCCGGACGG + Intronic
1083653977 11:64220212-64220234 GAACCACCTCACAGCCTGGAGGG - Exonic
1083667419 11:64283500-64283522 GACAGTCCTCCCAGACAGCAGGG - Intronic
1084745753 11:71168165-71168187 GACGCTCCTCACATCCCGCACGG + Intronic
1085042802 11:73336524-73336546 CATCCTCCTTTCAGCCAGCAGGG + Intronic
1085448640 11:76617478-76617500 GACCCAGCTCACATCCAGCAAGG - Intergenic
1086792786 11:91063471-91063493 GACGCTCCTCACATCCCGGATGG - Intergenic
1091304652 11:134529799-134529821 GACGGTGCTCCCAGCCAGCATGG - Intergenic
1091312140 11:134582158-134582180 CTCCATCCTCAAAGCCAGCAAGG - Intergenic
1091394549 12:145831-145853 GAGGCCGCTCACAGCCAGCATGG - Intronic
1092401739 12:8184036-8184058 GACGCTCCTCACATCCCGGACGG - Intronic
1094203060 12:27812733-27812755 GACCCCACCGACAGCCAGCAAGG + Intergenic
1099255577 12:80308347-80308369 GACGCTCCTCACATCCCGGACGG + Intronic
1099657355 12:85510039-85510061 TTCCCACCTGACAGCCAGCAAGG - Intergenic
1100577639 12:95907781-95907803 GACGCTCCTCACATCCCGGACGG + Intronic
1103872682 12:124102283-124102305 GACGCTCCTCACATCCCGGACGG + Intronic
1103932179 12:124456809-124456831 GACTCTCCTCACAGCCCGAGCGG + Intronic
1104748205 12:131222987-131223009 CACCCACCTCCCACCCAGCAAGG - Intergenic
1105893461 13:24698798-24698820 GACCTTCCACACAGCCTACATGG + Exonic
1106560245 13:30839946-30839968 GACGCTCCTCACATCCCGGACGG + Intergenic
1106581254 13:31020256-31020278 CAGCTTCATCACAGCCAGCAAGG + Intergenic
1107493072 13:40900404-40900426 GACGCTCCTCACATCCCGGACGG - Intergenic
1111399286 13:87711219-87711241 CACCCTCCACACAGCAAGCCTGG - Intergenic
1111730486 13:92070174-92070196 GCCCCAGCTGACAGCCAGCAAGG + Intronic
1111736156 13:92141847-92141869 GACCTGCCTTGCAGCCAGCAAGG - Intronic
1112056208 13:95691395-95691417 GACGCTCCTCACATCCCGGACGG + Intronic
1112917795 13:104572589-104572611 CACCCTCCACACACCCAGCTTGG - Intergenic
1113580175 13:111423099-111423121 GGCTCTCTTCACAGCCAGCCTGG - Intergenic
1113609720 13:111635527-111635549 GAGCGTCATCACAGCCAACACGG + Intronic
1113910919 13:113840860-113840882 GAGCCCTCTCTCAGCCAGCAGGG - Intronic
1114738651 14:25070250-25070272 GGCCCAGCTGACAGCCAGCAAGG - Intergenic
1117926934 14:60791000-60791022 TATCCTCCTGACAGACAGCAAGG - Intronic
1118866601 14:69709148-69709170 GTCCTTCCTCACTCCCAGCAAGG - Intronic
1118888988 14:69891593-69891615 TACCCTCCTCAGGGCCAGGAGGG + Intronic
1119894981 14:78212476-78212498 GACCCTCCTCACAATAAGCTGGG - Intergenic
1121450030 14:94001206-94001228 GAAGCTCTTCACAGCCAGCCAGG + Intergenic
1121502555 14:94449852-94449874 GGCCTCCCTCACATCCAGCATGG + Intronic
1122142607 14:99671895-99671917 GACCCTCCTCAAAGGCTGTAGGG + Intronic
1122549003 14:102539941-102539963 GACCCTCCCCAACACCAGCAAGG + Intergenic
1122817125 14:104319308-104319330 GACCCTCCTAATGGCCAGCCTGG - Intergenic
1122919763 14:104875181-104875203 GTCCCTCCTGAGTGCCAGCACGG - Intronic
1123112986 14:105881729-105881751 CAGCTGCCTCACAGCCAGCAGGG + Intergenic
1125878053 15:43167464-43167486 GACGCTCCTCACATCCCGGACGG + Intronic
1126981885 15:54253735-54253757 AACCCTCATCCCAGCCAACACGG - Intronic
1127154060 15:56109701-56109723 GACGCTCCTCACATCCCGGACGG - Intronic
1127493222 15:59484695-59484717 ATCTCTCCTCACAGCCACCACGG - Intronic
1128512358 15:68321305-68321327 CATCCTCCTCACAGGCAGCATGG - Intronic
1128587214 15:68860474-68860496 GACACTCCTCACATCCCGGACGG + Intronic
1129651772 15:77496115-77496137 GCCCCTCCTCCCACCCAGAAAGG - Intergenic
1130808086 15:87348107-87348129 GACCGTCCTCACACACAGCCAGG + Intergenic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133339532 16:5027601-5027623 GGCCCACCTCAAATCCAGCACGG - Intronic
1134082804 16:11336043-11336065 GACACTCCTCACATCCCGGATGG + Intronic
1137673465 16:50292359-50292381 GGCCCTCCACACAGCCAGCTGGG + Intronic
1140743731 16:77963338-77963360 CACCGTCTTCAAAGCCAGCAGGG - Intronic
1141423274 16:83930799-83930821 CCACATCCTCACAGCCAGCAGGG + Intronic
1141423300 16:83930884-83930906 CCACATCCTCACAGCCAGCAGGG + Intronic
1141486000 16:84340778-84340800 GTCCCTCCTGACAGCAAACAGGG + Intergenic
1141590100 16:85062769-85062791 GTCCCTGCTCAGAGCCAGCCCGG - Intronic
1141792369 16:86245433-86245455 CAGCTTCTTCACAGCCAGCATGG + Intergenic
1142383647 16:89748479-89748501 GACCCCACCCACAGCCAGGACGG - Intronic
1142469837 17:157168-157190 GGTCCTCCTCACAGCCCGCCCGG + Intronic
1142596524 17:1032276-1032298 CACCTTCCTCAGAGCCAGCTTGG + Intronic
1144621521 17:16821484-16821506 GTCCCTCCCCACAGCCAGGCAGG - Intergenic
1144868986 17:18356826-18356848 GACCCTCCTCCCCACCTGCAGGG + Intronic
1145147327 17:20493148-20493170 GTCCCTCCCCACAGCCAGGCAGG - Intergenic
1147573489 17:41585798-41585820 GTCCCTCCCCACAGCCAGGCGGG - Intronic
1147636755 17:41968664-41968686 GACCCTCCGCAAAGCCGGCCAGG + Exonic
1148658110 17:49303767-49303789 GACACTACTCACAGACAGAATGG + Intronic
1150213869 17:63456431-63456453 GACGCTCCTCACATCCCGGACGG - Intergenic
1150365565 17:64580862-64580884 GACTCTCCTCTCTGCCAGCCTGG + Exonic
1150839488 17:68594687-68594709 GCCCCAGCTGACAGCCAGCAAGG - Intronic
1151035104 17:70789648-70789670 GCCCCTGCTGACAGTCAGCAAGG - Intergenic
1151142755 17:72010673-72010695 GACCCGGCTGACAGCCAGCAGGG + Intergenic
1151992109 17:77582080-77582102 GCCTCTCCTAAAAGCCAGCAGGG - Intergenic
1152192462 17:78897049-78897071 GACCCTCCACCCAGGCAGCGTGG + Intronic
1152619372 17:81354340-81354362 GACCATGGTCACAGCCAGGATGG + Intergenic
1154440264 18:14383007-14383029 GACGCTCCTCACATCCCGGACGG + Intergenic
1157659661 18:49429114-49429136 TACCATCTTCAAAGCCAGCAAGG + Intronic
1159704999 18:71675223-71675245 CACACTCCACAGAGCCAGCAGGG - Intergenic
1160481603 18:79245688-79245710 TACCCTCCGCACAGTCAGTAGGG - Intronic
1160846263 19:1167537-1167559 CTCCCTCCTAAAAGCCAGCAGGG + Intronic
1161515712 19:4695214-4695236 GACCCTCTTCCCTGCCAGCCAGG + Intronic
1161936070 19:7372914-7372936 GCCCCTTCCCACAGCCAGCCTGG + Exonic
1162550705 19:11356899-11356921 GCCGCTCCTGGCAGCCAGCAGGG - Exonic
1163143017 19:15363013-15363035 GACGCTCCTCACATCCCGGACGG - Intronic
1163199982 19:15760165-15760187 GCCTCTACTGACAGCCAGCAGGG - Intergenic
1163287760 19:16359100-16359122 GGCCCCCCTGACTGCCAGCATGG + Intronic
1163373327 19:16914675-16914697 GACCCTGCCCACGGCCAGGAAGG + Exonic
1163542197 19:17918253-17918275 GACGCTCCTCACATCCCGGACGG - Intergenic
1165060038 19:33200710-33200732 CACCCTGCTCCCAGCCAGGAAGG - Intronic
1165295442 19:34922313-34922335 GACGCTCCTCACATCCCGGACGG + Intergenic
1167217667 19:48175569-48175591 GACCCTACTCACAGCCTTCTAGG - Intronic
1167492177 19:49799230-49799252 GACCCATCTCACAGCCCCCAAGG - Intronic
1167597327 19:50434710-50434732 GACCCACCCCACAGCCTGCTTGG - Intronic
1168646949 19:58065559-58065581 GTCCATCTTCACAGTCAGCAAGG + Intronic
1168696268 19:58405686-58405708 GACGCTCCTCACATCCCGGACGG + Intronic
1168720273 19:58550887-58550909 GACCCTCCCCATACCCAGAAAGG - Intergenic
925162805 2:1697843-1697865 GACCCTTCTCCCAACAAGCAAGG + Intronic
925971274 2:9108189-9108211 CACCATCTTCACAGGCAGCAAGG - Intergenic
926685415 2:15694221-15694243 GTCTCTCCACACAGCCAGCCCGG - Intronic
926748598 2:16180573-16180595 GGACCTCTTCACACCCAGCAAGG - Intergenic
927311646 2:21638489-21638511 CAACCTCATCACAGCCAGAAAGG - Intergenic
927757877 2:25723503-25723525 GACGCTCCTCACATCCCGGACGG + Intergenic
929062063 2:37933112-37933134 GACGCTCCTCACATCCCGGACGG + Intronic
930821383 2:55650682-55650704 GACGCTCCTCACATCCCGGACGG - Intronic
932367219 2:71161069-71161091 GACGCTCCTCACATCCCGGACGG - Intergenic
933225796 2:79748039-79748061 GCACCTCCTCACTGACAGCAAGG + Intronic
933677059 2:85066270-85066292 GCTCATCCACACAGCCAGCAGGG - Intergenic
933679815 2:85089781-85089803 GACCCTCTCCCCAGCCAGCAGGG + Intergenic
934549053 2:95243505-95243527 GACGCTCCTCACATCCCGGACGG - Intronic
934937933 2:98478631-98478653 GACCCTCTTCACAGCCACATTGG - Intronic
936243519 2:110807634-110807656 GACCCCGCACAGAGCCAGCAGGG + Intronic
936703360 2:115040327-115040349 AACCCTCCTCAGAGTTAGCAGGG + Intronic
936911924 2:117602334-117602356 AATTCTCCTCACAGACAGCAAGG + Intergenic
938483264 2:131679640-131679662 CACCCTCCACACAACCATCAAGG + Intergenic
938711508 2:133979501-133979523 GCCCCTGCTGACAGCCATCAAGG - Intergenic
939057244 2:137380569-137380591 CTCCCTCTTCAAAGCCAGCAGGG - Intronic
939191314 2:138919631-138919653 GGCCTTCCTCACAGTCAACATGG + Intergenic
941603213 2:167564203-167564225 GACGCTCCTCACATCCCGGACGG + Intergenic
941847762 2:170149813-170149835 GACGCTCCTCACATCCCGGACGG - Intergenic
943026588 2:182636866-182636888 CCCCCTGCTGACAGCCAGCAAGG - Intergenic
944255299 2:197618741-197618763 GACGCTCCTCACATCCCGGACGG - Intronic
944797919 2:203207074-203207096 GACGCTCCTCACATCCCGGACGG - Intronic
946318106 2:218931454-218931476 GACGCTCCTCACATCCCGGACGG - Intergenic
946650924 2:221892114-221892136 GACGCTCCTCACATCCCGGACGG - Intergenic
946878516 2:224154831-224154853 CCCCTACCTCACAGCCAGCAAGG - Intergenic
948470250 2:238172946-238172968 GGCCCTGCCCTCAGCCAGCACGG + Intronic
949052148 2:241903139-241903161 GACCCTCCTCGCCGCCCGCTCGG + Intergenic
1168962429 20:1878332-1878354 GCCCCTCCTCATCGCCATCAAGG - Intergenic
1168979092 20:1989853-1989875 AACCATCCTAACAGCCAGCAAGG + Intronic
1169252983 20:4074363-4074385 GCCTCTTCTCACATCCAGCAGGG - Intronic
1169445491 20:5667779-5667801 GCCCTCACTCACAGCCAGCAAGG + Intergenic
1170030825 20:11942225-11942247 GCCTCTGCTAACAGCCAGCAAGG + Intergenic
1170909416 20:20549834-20549856 AACCTTCCTCACAGCCTCCAGGG + Intronic
1171277695 20:23872336-23872358 GAGCCTCCTCACATTCAGGAAGG + Intergenic
1171451253 20:25237580-25237602 GGCCCTCCCCACACCCAACAGGG - Intergenic
1171967919 20:31544292-31544314 GCCCCACCTCCCAGCCAGGAAGG - Intronic
1172205511 20:33160272-33160294 GACTCTCCCCGCAGCCTGCAGGG - Intergenic
1174020683 20:47526101-47526123 GACGCTCCTCACATCCCGGACGG + Intronic
1174344829 20:49922105-49922127 GACGCTCCTCACATCCCGGACGG - Intergenic
1175222203 20:57423708-57423730 GCCCCAGCTCCCAGCCAGCAAGG - Intergenic
1175273244 20:57749465-57749487 GACCTTCCTCAATGCCAGCCTGG + Intergenic
1175609722 20:60340454-60340476 GTTTCTCCTCCCAGCCAGCAGGG - Intergenic
1175719824 20:61279349-61279371 GAGCCTCCTCCCAGGCAGCAAGG + Intronic
1175768138 20:61605282-61605304 GACCCACCCCACAGGCAGCAGGG - Intronic
1176120609 20:63452950-63452972 GACCCTCCCCTCAGCCTGCAGGG - Intronic
1176187706 20:63790257-63790279 GATGCTCCTCCCAGCCATCACGG + Exonic
1178920510 21:36735454-36735476 GACGCTCCTGTCAGCCAACAGGG - Intronic
1179553854 21:42160231-42160253 CCCCCGCCTCACAGCCACCAGGG - Intergenic
1179955427 21:44735625-44735647 GAGCCTCCACACAGGCAGCGAGG + Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180115932 21:45705036-45705058 AGAGCTCCTCACAGCCAGCAAGG - Intronic
1180570856 22:16717730-16717752 TGCGATCCTCACAGCCAGCATGG - Intergenic
1180831004 22:18906136-18906158 AACCCTCCTTGCAGCCACCACGG + Intronic
1180969720 22:19808913-19808935 GACCCTCCCCACAGCCCTGACGG - Intronic
1181235448 22:21445552-21445574 GACCCGCCTCCCCGCCAGCTGGG - Exonic
1181301568 22:21884121-21884143 GACGCTCCTCACATCCTGGACGG + Intergenic
1181547828 22:23613204-23613226 GCCCCTCCTCACAAGCAACAGGG + Intronic
1181658050 22:24317862-24317884 GACGCTCCTCACATCCCGGACGG + Intronic
1181792346 22:25277965-25277987 GACGCTCCTCACATCCCGGACGG + Intergenic
1182358130 22:29731434-29731456 GACCCTCCCCACAGCCAGGGTGG - Exonic
1183714342 22:39525047-39525069 GACCCTCCTCACAGCCTCTCAGG - Intergenic
1183940913 22:41294707-41294729 GACGCTCCTCACATCCCGGACGG - Intergenic
1184462218 22:44645711-44645733 CACCCACCACACGGCCAGCAGGG - Intergenic
1184567200 22:45299156-45299178 CAGCCTGCTCACAGCCAACAGGG + Intergenic
1184746567 22:46459566-46459588 CACCCTCCACAGTGCCAGCAGGG + Intronic
1203281091 22_KI270734v1_random:131407-131429 AACCCTCCTTGCAGCCACCACGG + Intergenic
949567138 3:5255357-5255379 GCCCCAGCTGACAGCCAGCAAGG - Intergenic
950949195 3:16980476-16980498 GACGCTCCTCACATCCCGGACGG + Intronic
952738133 3:36710441-36710463 AAGCTTCCTCAAAGCCAGCAGGG + Intergenic
953141550 3:40233967-40233989 GTCCCTCCTGACAGACAGAAGGG + Exonic
953831451 3:46301120-46301142 GATCCTAGTCACAGCAAGCATGG - Intergenic
954195747 3:48995991-48996013 CACCCTCTTCAAAGGCAGCAGGG + Intronic
954199420 3:49015321-49015343 GGGCCTGCTCACAGACAGCATGG + Exonic
954356299 3:50085189-50085211 GACGCTCCTCACATCCCGGACGG + Intronic
954399657 3:50312329-50312351 GACGCTCCTCACATCCCGGACGG + Intronic
954909614 3:54092761-54092783 GCCCCACCTGACAGCCAGCAAGG + Intergenic
955007791 3:54986027-54986049 GTTCCTCCTCCCAGCCAACAGGG - Intronic
955699835 3:61672060-61672082 GACGCTCCTCACATCCCGGACGG + Intronic
958755064 3:98242122-98242144 GACCTTCCTCTCAGTCAGTAAGG + Intergenic
959167324 3:102796979-102797001 GCCCATCCTCAAAGCCAGCCAGG + Intergenic
961203594 3:125063282-125063304 CATCCTCCCCACAGCAAGCAGGG + Intergenic
961378239 3:126481260-126481282 GTCCCTCCTAACAGCAAGGAAGG + Intronic
962347197 3:134626693-134626715 GACCCTCTTCTGGGCCAGCATGG + Intronic
965496831 3:169408918-169408940 CAGTCTCCTCACAGCTAGCATGG + Intronic
966253487 3:177891919-177891941 GACGCTCCTCACATCCCGGACGG + Intergenic
966420236 3:179728322-179728344 GACGCTCCTCACATCCCGGACGG + Intronic
967729098 3:192890780-192890802 GATCCTCCTCACATCCTCCATGG + Intronic
967839890 3:193996785-193996807 GTCTCTCTTCATAGCCAGCACGG - Intergenic
968411627 4:395649-395671 GACGCTCCTCACATCCTGGACGG - Intergenic
968869940 4:3236662-3236684 CACCCTGCTCACAGGCACCACGG - Intronic
968895714 4:3401931-3401953 GAGCCTCTCCACAGTCAGCAAGG + Intronic
968910753 4:3475961-3475983 GGCACTCCTCACAGCCACGAGGG - Intronic
969375496 4:6760896-6760918 GACCCTCATCACAGCCCTCCTGG + Intergenic
969601245 4:8177765-8177787 CACCCTCCCCAAAGCCAGCTTGG - Intergenic
970009604 4:11444634-11444656 CTTGCTCCTCACAGCCAGCAAGG - Intergenic
971245846 4:24926933-24926955 CACACTCCTTACAGGCAGCACGG + Intronic
971280064 4:25235259-25235281 ATCCATCCTCACAACCAGCAGGG - Intronic
973109065 4:46377390-46377412 GACGCTCCTCACATCCCGGACGG - Intronic
973567376 4:52201859-52201881 CTCCATCTTCACAGCCAGCAAGG - Intergenic
976607377 4:86995927-86995949 GACGCTCCTCACATCCCGGACGG - Intronic
979350283 4:119636504-119636526 TAGCTTCCTCAAAGCCAGCAAGG + Intergenic
982053657 4:151526864-151526886 GACGCTCCTCACATCCCGGACGG + Intronic
983416135 4:167457451-167457473 GAGACTCTTCACAGGCAGCAAGG - Intergenic
984330309 4:178306864-178306886 CCCCCAGCTCACAGCCAGCAAGG - Intergenic
985645987 5:1084989-1085011 GACCCTCCTCAGTGGCAGGAGGG - Intronic
985850885 5:2388351-2388373 GACCCTCGTCCCAGGCCGCAAGG - Intergenic
986146201 5:5080120-5080142 GCATCTCCTCAGAGCCAGCAAGG - Intergenic
987833974 5:23136997-23137019 CAGCATCCTCAAAGCCAGCAAGG - Intergenic
988842594 5:35097586-35097608 CCCACTCCTCACAGCCAGCATGG - Intronic
989048419 5:37295702-37295724 GACGCTCCTCACATCCCGGACGG - Intronic
989300385 5:39884732-39884754 CCCCCTGCTGACAGCCAGCAAGG + Intergenic
991377072 5:65977497-65977519 GACGCTCCTCACATCCCGGACGG + Intronic
991597922 5:68323894-68323916 GACGCTCCTCACATCCTGGATGG + Intergenic
991664918 5:68990065-68990087 GGCCCTCATCACACCAAGCATGG + Intergenic
992568381 5:78025404-78025426 GTCCCTCCTCGCAACAAGCAAGG + Intronic
993496569 5:88615809-88615831 GACGCTCCTCACATCCCGGACGG - Intergenic
994350724 5:98742870-98742892 CACATTCCTCAGAGCCAGCAGGG - Intergenic
994625627 5:102215163-102215185 TACCCTCCCCACCCCCAGCAGGG + Intergenic
995123647 5:108559470-108559492 GACGCTCCTCACATCCCGGACGG + Intergenic
997241187 5:132309347-132309369 GACCCTGCTTACAACCAGCAGGG - Intronic
997350348 5:133226489-133226511 GCCCCTCCCCACAGCCAGGCTGG - Intronic
997565330 5:134882183-134882205 GACGCTCCTCACATCCCGGACGG + Intronic
997662928 5:135603421-135603443 GACACTCCTCAAAGCCAGCATGG - Intergenic
998607265 5:143648122-143648144 GCCCATCCTACCAGCCAGCATGG + Intergenic
999181170 5:149670776-149670798 GACGCTCCTCACATCCCGGACGG + Intergenic
999702997 5:154245194-154245216 GCCCATCCTCACTGCCACCATGG - Intronic
1001065572 5:168532689-168532711 GCCCCTCCTCAGAGCCAGATGGG + Intergenic
1002050611 5:176568597-176568619 GCCCAGCCTCACAGCCAGCTTGG + Intronic
1002583504 5:180225665-180225687 GCCCCAGCTAACAGCCAGCAAGG + Intergenic
1004691491 6:17996136-17996158 GACCCTCCTCACTGCTAGCTTGG - Intergenic
1005158715 6:22836389-22836411 GACGCTCCTCACATCCGGGACGG - Intergenic
1006141542 6:31932456-31932478 GACGCTCCTCACATCCCGGATGG + Intronic
1006281923 6:33060093-33060115 GACGCTCCTCACATCCCGGACGG + Intergenic
1009269286 6:61598111-61598133 CAGACTCCTCACAGTCAGCAGGG - Intergenic
1010559538 6:77333068-77333090 CACGCTCCGCAGAGCCAGCAGGG + Intergenic
1015220815 6:130802296-130802318 GACGCTCCTCACATCCCGGACGG - Intergenic
1015631453 6:135236013-135236035 CTCCCACCTGACAGCCAGCAAGG + Intergenic
1015643721 6:135364232-135364254 GACGCTCCTCACATCCTGGACGG + Intronic
1016802246 6:148179164-148179186 GACGCTCCTCACATCCCGGACGG + Intergenic
1017021579 6:150143732-150143754 AACCCTCCCCACGGCCACCAAGG - Intronic
1020831680 7:13102609-13102631 GACGCTCCTCACATCCCGGACGG - Intergenic
1021981052 7:26055955-26055977 GAGCATCTGCACAGCCAGCAAGG + Intergenic
1022274068 7:28838807-28838829 GACGCTCCTCACATCCCGGACGG - Intergenic
1023160549 7:37292603-37292625 GACGCTCCTCACATCCCGGACGG - Intronic
1024093904 7:45969351-45969373 GACACTCCTTCCTGCCAGCATGG - Intergenic
1024313101 7:47987998-47988020 GCTCCTCGGCACAGCCAGCAAGG - Intronic
1025821682 7:64968450-64968472 GACGCTCCTCACATCCCACACGG + Intergenic
1026862113 7:73797422-73797444 GACGCTCCTCACATCCCGGACGG + Intergenic
1028028367 7:85875699-85875721 GAGCTCCCACACAGCCAGCAAGG - Intergenic
1029580734 7:101435405-101435427 GTCCAGCCTCCCAGCCAGCAGGG - Intronic
1030825696 7:114155194-114155216 GACCCACCTCTCATCCAGGAAGG + Intronic
1032853391 7:135814199-135814221 GTCCTGCCTCCCAGCCAGCAAGG + Intergenic
1033219759 7:139520315-139520337 GACGCTCCTCACATCCCGGACGG + Intergenic
1038018613 8:23534753-23534775 AACCCTCCTCACAACCACCCTGG - Intronic
1040043539 8:42939823-42939845 GACGCTCCTCACATCCCGGACGG + Intronic
1040392524 8:46962031-46962053 GAGGCCCCTCACTGCCAGCAAGG + Intergenic
1040644292 8:49380265-49380287 CCCCCTGCTCACAGCCAGCAGGG + Intergenic
1041677315 8:60548980-60549002 GACGCTCCTCACATCCCGGACGG + Intronic
1041706029 8:60847174-60847196 GAGCCTACTCACGGCCAGCATGG - Intronic
1042666188 8:71209137-71209159 GACCCTCCTAGTGGCCAGCAGGG - Intronic
1044223631 8:89698727-89698749 GACGCTCCTCACATCCCGGACGG - Intergenic
1047782166 8:128119078-128119100 GACGCTCCTCACATCCCGGACGG + Intergenic
1049219187 8:141421139-141421161 TAGCCACCACACAGCCAGCAGGG - Intronic
1049415092 8:142491439-142491461 GGCCATCCTCCCAGACAGCAAGG + Intronic
1049593538 8:143473213-143473235 GACCCTGTGCACAGCCAGCAGGG - Intronic
1049868890 8:144958250-144958272 TACCCTCCTCACACCCAGTCCGG - Intergenic
1051430669 9:16977671-16977693 GACGCTCCTCACATCCCGGACGG + Intergenic
1051911326 9:22155532-22155554 GACGCTGCTCACATCCTGCACGG - Intergenic
1055138771 9:72851609-72851631 GACGCTCCTCACATCCCGGACGG + Intergenic
1055461093 9:76520952-76520974 GAGCCACCACACAGCCAGCCAGG + Intergenic
1055513961 9:77019210-77019232 GACCTTCCTCCCAGCCATCTTGG + Intergenic
1056078810 9:83068490-83068512 CACCCTGCTGACAGCCAGCAAGG + Intergenic
1056409564 9:86312275-86312297 GACGCTCCTCACATCCCGGACGG - Intronic
1057155137 9:92831799-92831821 GACGCTCCTCACATCCCGGACGG + Intergenic
1057751480 9:97796539-97796561 GACGCTCCTCACATCCCGGACGG - Intergenic
1057910357 9:99015521-99015543 GGCTCCCCTCACAGCCACCATGG + Exonic
1058423315 9:104854186-104854208 GCCCCTGCTGACAGCCAGCAAGG + Intronic
1058529045 9:105887922-105887944 GACTCTCCCCACAGCCCCCAAGG - Intergenic
1058972658 9:110097501-110097523 GACGCTCCTCACATCCCGGACGG + Intronic
1059707818 9:116840718-116840740 GACGCTCCTCACATCCCGGACGG + Intronic
1060682308 9:125577174-125577196 GACGCTCCTCACATCCCGGACGG - Intronic
1060790579 9:126483025-126483047 GAGCCTCCGCGAAGCCAGCAGGG - Intronic
1060926262 9:127457400-127457422 GGCCCTCCTCCCAGGCAGCTGGG + Intronic
1061404131 9:130384352-130384374 GACTATCCCCACAGCCACCACGG - Intronic
1061431254 9:130532780-130532802 AACCCTCCTCTCAGCCCTCAGGG - Intergenic
1061886276 9:133592506-133592528 GCCCCTCAGCACAGCCAGCGTGG - Intergenic
1062094448 9:134695628-134695650 CCCCCTCCTCTCAGCCATCAGGG - Intronic
1062164270 9:135098983-135099005 GCCCCTGCTCACAGCCTGGAAGG + Intronic
1062386100 9:136312100-136312122 GACCCCCCACCCAGCCAGCAGGG + Intergenic
1062545631 9:137062626-137062648 GACGCTGCTCACATCCTGCACGG + Exonic
1187184351 X:16969066-16969088 GACGCTCCTCACATCCCGGATGG + Intronic
1188071120 X:25719652-25719674 GCCCCTGCTGACAGCTAGCAAGG - Intergenic
1189616198 X:42786811-42786833 GACGCTCATCAAAGACAGCAAGG - Intergenic
1190277828 X:48910664-48910686 GATCCTCCTCATACCCAGAATGG + Intronic
1192147598 X:68692348-68692370 GACTCTCATCAGGGCCAGCAGGG + Intronic
1198948657 X:142043650-142043672 GACCCTATGCACAGCCAGAATGG - Intergenic
1199760822 X:150902675-150902697 GCCCCTCCCCCCAGCCAGCCAGG - Intergenic
1199880005 X:151966563-151966585 GATCCTCATGACAGCCTGCATGG - Intronic
1200042155 X:153378557-153378579 GCCCCTGTTGACAGCCAGCAAGG + Intergenic
1200067432 X:153510564-153510586 GCCCCTCCTCCCAGCCAGCGAGG - Intergenic
1200122351 X:153797194-153797216 GCCCCTGCTCACAGTCAACAGGG + Intronic