ID: 1072691183

View in Genome Browser
Species Human (GRCh38)
Location 10:97573130-97573152
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072691178_1072691183 -6 Left 1072691178 10:97573113-97573135 CCTAAGACTGCTCACCCTCCTGG 0: 1
1: 1
2: 0
3: 22
4: 227
Right 1072691183 10:97573130-97573152 TCCTGGGCCTTGAGAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr