ID: 1072695790

View in Genome Browser
Species Human (GRCh38)
Location 10:97601875-97601897
Sequence GCGCCCTGGCCAATGTCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072695790 Original CRISPR GCGCCCTGGCCAATGTCCTG GGG Exonic
901644059 1:10707152-10707174 GTGCCCTGGCCAGCCTCCTGTGG + Intronic
903040078 1:20522901-20522923 GATCTCTGGCAAATGTCCTGAGG + Intergenic
904369271 1:30038229-30038251 GGGCACTGGCCACTGTCCTCTGG + Intergenic
904689823 1:32285566-32285588 GCGCCCTGACAACTGTCCAGAGG + Exonic
905036013 1:34918746-34918768 GGGCCCTGGCCAGGGTCCTAGGG - Intronic
905769102 1:40625864-40625886 GCTCCCTGGCCAGGGCCCTGGGG - Exonic
907328239 1:53654689-53654711 GAGCCCTGGCAAATGCACTGAGG + Intronic
910715944 1:90230415-90230437 TTGCCCAGGCCAATGTCCTGGGG + Intergenic
919845253 1:201638273-201638295 GCCCCATGACCTATGTCCTGGGG - Intronic
921775394 1:219093595-219093617 TTGCCCAGACCAATGTCCTGTGG - Intergenic
923729601 1:236537707-236537729 CAGCCCTGGCCAAGGTGCTGAGG + Intronic
924878825 1:248136117-248136139 TTGCCCAGTCCAATGTCCTGGGG - Intergenic
924903406 1:248426511-248426533 GGGCCCTGACCAATGCCCAGAGG + Intergenic
924924456 1:248665293-248665315 GGGCCCTGACCAATGCCCAGAGG - Intergenic
1062844083 10:690855-690877 CAGCGCTGGCCAATGTCCCGTGG - Intergenic
1064028775 10:11869899-11869921 CCGCCCTGGACAGGGTCCTGCGG - Exonic
1067139859 10:43648291-43648313 GCGGTCTGGAAAATGTCCTGGGG + Intronic
1067683769 10:48455580-48455602 GCTCCCTGGCCCATGTCCCAGGG - Intronic
1068721690 10:60252923-60252945 GAGCCCTTGCCCATGTCTTGTGG + Intronic
1070105404 10:73426340-73426362 TGGCCATGGCCAAGGTCCTGAGG + Exonic
1071376183 10:85007025-85007047 GAGCCCTGGCCAATGGCTAGAGG + Intergenic
1072695790 10:97601875-97601897 GCGCCCTGGCCAATGTCCTGGGG + Exonic
1073425933 10:103455492-103455514 GGGCCGTGGCCAGTGTCCCGTGG + Exonic
1073693500 10:105838071-105838093 GCCCTCTCTCCAATGTCCTGTGG + Intergenic
1075852651 10:125601890-125601912 TCGCCCTGGACAAGGTCCAGAGG + Intronic
1075856918 10:125637734-125637756 GCTGCCTGGCAAATCTCCTGGGG - Intronic
1075859343 10:125661468-125661490 GAGCCCTGGCCCAAGGCCTGGGG + Intronic
1076179800 10:128398310-128398332 GCGCCCTGGGCAGTGTGCTGTGG - Intergenic
1076869199 10:133185046-133185068 GTGCCCTGGCTACCGTCCTGAGG - Intronic
1077007517 11:365257-365279 GCGGCATCGCCATTGTCCTGGGG + Intergenic
1077071616 11:676496-676518 GCGCCGTGGACAATGACCAGGGG + Intronic
1077367199 11:2166042-2166064 GACGCCAGGCCAATGTCCTGTGG + Exonic
1077460873 11:2708750-2708772 TAGCCCTGGCCATTGGCCTGGGG - Intronic
1078131956 11:8620601-8620623 GTGCTCTGGGCAATGTGCTGAGG - Intronic
1078151029 11:8759806-8759828 GGGCCCTGGCCAAGGACATGAGG + Intronic
1082811718 11:57482661-57482683 GAGCCCTGGCCTCTGCCCTGTGG - Intergenic
1083353372 11:62047119-62047141 GCTCCCTGGCCTCTGCCCTGGGG - Intergenic
1083713425 11:64562351-64562373 GCGGCCTGGCCTTTGCCCTGCGG + Exonic
1083897736 11:65628640-65628662 GCGCCCTGGCAGATCACCTGGGG + Exonic
1092208826 12:6633234-6633256 GCCCCCTGACCTGTGTCCTGAGG + Intronic
1095860642 12:46913891-46913913 TTGCCCAGACCAATGTCCTGGGG - Intergenic
1096560275 12:52431161-52431183 GCCCCCTGACCAATGAGCTGAGG + Intronic
1102437757 12:112938631-112938653 GCGCCCTGGCCGCTGCCCTGAGG + Exonic
1102646163 12:114405347-114405369 GCGCCCTCGCCAGGGTCCCGGGG + Intronic
1103316580 12:120060979-120061001 GAGCCCTGCCCACTGTCCTGTGG - Intronic
1103593095 12:122006149-122006171 CCGCCCTGGCCAAGGTGCTTGGG + Intergenic
1104885309 12:132104053-132104075 GCGCCATGTCCAGTGGCCTGGGG + Exonic
1104946137 12:132415638-132415660 GGGTCCTGGCAAGTGTCCTGGGG + Intergenic
1107089835 13:36466615-36466637 TTGCCCCAGCCAATGTCCTGAGG + Intergenic
1109046187 13:57414118-57414140 TTGCCCAGACCAATGTCCTGGGG - Intergenic
1112280671 13:98060425-98060447 GCTCACTGGCCAAGGGCCTGGGG + Intergenic
1113779234 13:112966641-112966663 GTCCCCTGGCCAATATCCTCTGG - Intronic
1116109814 14:40563600-40563622 TTGCCCAGGCCAATGTCCTGGGG + Intergenic
1118761430 14:68882482-68882504 GAGCCCAGGCCAATGTCATCGGG - Exonic
1119563382 14:75608533-75608555 CCTCCCAGGCCTATGTCCTGAGG - Intronic
1122917210 14:104864880-104864902 GCGCCCTGGCCCAGGGCCAGCGG - Intergenic
1123102946 14:105818135-105818157 GGGCCCTGGCCCATGTCAGGAGG + Intergenic
1131049897 15:89340704-89340726 GAGCCCTGGCCAGGGCCCTGTGG + Intergenic
1132145111 15:99425011-99425033 GAGGCCAGGCCACTGTCCTGAGG + Intergenic
1132230999 15:100184213-100184235 TCTCCCTGGCCAATGGACTGGGG - Intronic
1132847301 16:2006503-2006525 CCACCCTGGCCACTGTGCTGCGG - Intronic
1138300556 16:55924938-55924960 TTGCCCAGACCAATGTCCTGTGG - Intronic
1138528978 16:57624834-57624856 GTGCCCTGGCCAATGCATTGGGG + Intronic
1139593871 16:67947300-67947322 GCGCCCTGGCCAGGGTCTGGCGG + Intronic
1141870046 16:86779090-86779112 CCACCGTGGCCCATGTCCTGTGG + Intergenic
1142099065 16:88261940-88261962 GCGCCATGGCCCCTGTTCTGTGG - Intergenic
1142205936 16:88783220-88783242 GCCCCCTGACCAATGCCCAGGGG + Intronic
1144206851 17:12985455-12985477 CCTCCCTGGCCAATTCCCTGAGG + Intronic
1145935850 17:28714411-28714433 GCGCCCTGGACAGTCCCCTGAGG + Exonic
1147189634 17:38730938-38730960 GCGCCCTGCCCAGTGCCCTCTGG - Intronic
1147627731 17:41910676-41910698 GCGCCCGGACCCATGTCCTGAGG - Intronic
1151243339 17:72775267-72775289 CCCCACTGGCCACTGTCCTGGGG + Intronic
1153092591 18:1365117-1365139 TTGCCCAGGCCAATGTTCTGGGG + Intergenic
1155356478 18:24958574-24958596 GAGCGCTGACAAATGTCCTGTGG + Intergenic
1156277682 18:35599288-35599310 TTGCCCAGACCAATGTCCTGAGG + Intronic
1158543853 18:58379280-58379302 GCGCCCTGGCCCCCGTCATGAGG - Intronic
1158629579 18:59100268-59100290 CTCCCCTAGCCAATGTCCTGGGG + Intergenic
1162435575 19:10655897-10655919 GAGCACCTGCCAATGTCCTGCGG - Intronic
1163219386 19:15903905-15903927 TTGCCCAGACCAATGTCCTGAGG + Intergenic
1163406964 19:17128797-17128819 AGGCCCTGGCCAGTGTCATGTGG + Intronic
1166533033 19:43553718-43553740 GGGCCCTGGCCTCTGTCCTTGGG - Intronic
1167072362 19:47228319-47228341 GTGCCCTCGGCAGTGTCCTGCGG - Exonic
1167492779 19:49801813-49801835 GCGCCCTGGACGATGGCCGGAGG + Exonic
926141945 2:10373038-10373060 GAGCCCTGGGCAGTGTTCTGAGG + Intronic
926738727 2:16093866-16093888 GCTTCCTGGCCAGGGTCCTGAGG + Intergenic
927044965 2:19268468-19268490 TTGCCCAGACCAATGTCCTGGGG - Intergenic
928115459 2:28542681-28542703 GCCCCTTGCCCAGTGTCCTGGGG - Intronic
931907703 2:66860361-66860383 GTGCCCCAGCCAATTTCCTGAGG - Intergenic
932399230 2:71468238-71468260 GTGCCCTGCCCAGTGTCCTTAGG - Intronic
937934000 2:127227736-127227758 GTGCCCTGGCCCCTGTCCTGAGG + Intergenic
945258217 2:207820195-207820217 GAGCCCAGGCCGATTTCCTGAGG + Intergenic
945771409 2:214047613-214047635 TTGCCCAGACCAATGTCCTGGGG - Intronic
947536707 2:230944200-230944222 TTGCCCTGTCCAATGTCCAGTGG - Intronic
947860227 2:233353307-233353329 CCGCCCTGGGCAGTGACCTGGGG - Intergenic
948425585 2:237885033-237885055 GCACCCTGCCCAACGTCGTGTGG - Intronic
1170511202 20:17078603-17078625 GCGCCCTGACCACTGCCCTTTGG - Intergenic
1171024817 20:21620376-21620398 TTGCCCAGACCAATGTCCTGGGG - Intergenic
1172785398 20:37465066-37465088 CCTCCCTGGCCAATGTCATCAGG + Intergenic
1173106875 20:40145096-40145118 ACTCCTTGGCCAATCTCCTGGGG + Intergenic
1179557707 21:42191047-42191069 GGGCCCTGCCCACTGTCCTGAGG + Intergenic
1180832297 22:18912403-18912425 GCAGCCTGGTCAGTGTCCTGTGG + Intronic
1181067544 22:20313939-20313961 GCAGCCTGGTCAGTGTCCTGTGG - Intergenic
1182327644 22:29525804-29525826 GCGCTCTGGGCAATGACGTGCGG - Intronic
1183424965 22:37734521-37734543 GGGTCCTGGCTGATGTCCTGGGG - Exonic
1184690277 22:46114321-46114343 GTGCCCTGGAAACTGTCCTGAGG - Intergenic
1185315760 22:50178471-50178493 GCGCCCTGGCCAGGCTCCCGTGG - Intronic
1203282383 22_KI270734v1_random:137708-137730 GCAGCCTGGTCAGTGTCCTGTGG + Intergenic
949414622 3:3800776-3800798 GCCACCTGGCAAACGTCCTGAGG - Intronic
950898876 3:16478646-16478668 CAGCCCTGGCCAATGTCCTCAGG - Intronic
952044754 3:29305090-29305112 GAGCTCTTGCCAAGGTCCTGGGG - Intronic
952887192 3:38019016-38019038 GGGTCCTGTCCAGTGTCCTGAGG + Intronic
954675696 3:52314254-52314276 CCCCCCTGGGAAATGTCCTGTGG + Intergenic
955462592 3:59200920-59200942 TTGCCCAGACCAATGTCCTGGGG + Intergenic
956780474 3:72599389-72599411 GCGCCCCGGCCAAGGTCCCAGGG - Intergenic
957380893 3:79427862-79427884 TTGCCCAGTCCAATGTCCTGGGG - Intronic
961793682 3:129394225-129394247 GGCCCTTGCCCAATGTCCTGAGG - Intergenic
962271082 3:133978568-133978590 GAGCCCGGGCCCCTGTCCTGTGG - Intronic
962992482 3:140591678-140591700 TAGTCCTGGCCAATGTGCTGTGG + Intergenic
963284941 3:143425044-143425066 TCTCCCTGGCAAATGCCCTGAGG - Intronic
964322906 3:155516684-155516706 GTGCCTAGGCCAATGTGCTGGGG + Intronic
968093258 3:195910617-195910639 GCGCTCTGGCCAAGTCCCTGGGG - Intronic
968564821 4:1306048-1306070 GGGCCCTGCCCAATCTGCTGAGG - Intronic
968733362 4:2282378-2282400 GAAACCTGGCCACTGTCCTGTGG - Intronic
971801309 4:31295292-31295314 GCACCGTTGCCAATGTCCTGTGG + Intergenic
978098394 4:104807268-104807290 TTGCCTAGGCCAATGTCCTGGGG - Intergenic
979091471 4:116488580-116488602 GTGCCCAGTGCAATGTCCTGGGG + Intergenic
982662638 4:158225233-158225255 GGGCCCTGGCCAAGGGCCAGTGG - Intronic
982719707 4:158847420-158847442 GAGCACTGGGCAATGTCATGAGG + Intronic
983221483 4:165048189-165048211 GTGCCCTGGGCTGTGTCCTGTGG - Intergenic
983457118 4:167979079-167979101 TTGCCCAGACCAATGTCCTGGGG - Intergenic
984020700 4:174481585-174481607 TTGCCCAGGCCAATGTCCAGAGG - Intergenic
985180242 4:187252702-187252724 GCACCCTGGTCATAGTCCTGAGG - Intergenic
985198253 4:187456413-187456435 GTGCCCTGGCCACTCTCCTCAGG + Intergenic
985633965 5:1027043-1027065 ACAGCCTGGCCCATGTCCTGTGG - Intronic
988778351 5:34497100-34497122 GAGCGCTGGACAATTTCCTGTGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
992179883 5:74185459-74185481 GAGCCCTAGCCAATGCCTTGGGG + Intergenic
994381769 5:99079768-99079790 GGGCCCTGGCCAGAGTCATGAGG - Intergenic
1002382298 5:178839521-178839543 GCTCCCCTGCCAATGTCCTCTGG - Intergenic
1002648334 5:180673476-180673498 GCTCCCCTGCCAATGTCCTCTGG + Intergenic
1003410334 6:5856320-5856342 GCTCCCTGTCCTATGTCCTGCGG + Intergenic
1007548001 6:42708705-42708727 GAGCCATTGCCAGTGTCCTGTGG + Intronic
1017633623 6:156422902-156422924 CATCCCTGGCCAATCTCCTGGGG - Intergenic
1018843912 6:167540837-167540859 GTGCCCCGTCCAGTGTCCTGTGG - Intergenic
1019481745 7:1270156-1270178 GCGACCTGGGCACGGTCCTGGGG + Intergenic
1019539982 7:1547106-1547128 GCGTCCTGCACGATGTCCTGGGG + Exonic
1019603434 7:1896423-1896445 CAGCCCTGCCCAATGTCCTCAGG - Intronic
1023871807 7:44267216-44267238 GACCCCTGGCCAAGGTCTTGGGG + Intronic
1023874882 7:44281564-44281586 GAGGCCTGGCCAGGGTCCTGGGG - Intronic
1025022618 7:55491590-55491612 GCTCCCTGGCCTGTGTCCTAAGG + Intronic
1033628318 7:143132648-143132670 AGGCCCTGGCCACTGCCCTGTGG + Intronic
1033654992 7:143367141-143367163 GGGTCCTGGCCATTGTGCTGGGG + Intergenic
1034940636 7:155228166-155228188 GGGCTCAGGCCACTGTCCTGGGG + Intergenic
1035413581 7:158666032-158666054 TGGCCCTGTCCACTGTCCTGTGG - Intronic
1037667785 8:20985296-20985318 GCACCCTGGTCACTGTGCTGAGG + Intergenic
1041365907 8:57104473-57104495 TTGCCCAGACCAATGTCCTGGGG - Intergenic
1044727437 8:95204885-95204907 TCTCCCTGGGCACTGTCCTGTGG + Intergenic
1048269774 8:133019386-133019408 GCTCTCTGGCCACTGGCCTGTGG - Intronic
1049254147 8:141605016-141605038 GAGCCCAGGCCGGTGTCCTGAGG + Intergenic
1049603634 8:143519276-143519298 GACTCCTGGCCAATGCCCTGGGG + Intronic
1049740316 8:144237347-144237369 GCGCGCAGGCCCCTGTCCTGAGG + Intronic
1051004571 9:12327764-12327786 TTGCCCAGGCCAATATCCTGTGG + Intergenic
1056806721 9:89734709-89734731 GCGCCCTGGCAAGGGCCCTGGGG + Intergenic
1057529081 9:95828248-95828270 CAGCCATTGCCAATGTCCTGGGG - Intergenic
1057706706 9:97399904-97399926 GTGCCCAGACCAATGGCCTGAGG + Intergenic
1059291010 9:113223632-113223654 GCTTCCTGGCCAATCTTCTGGGG - Intronic
1060047364 9:120351380-120351402 GTGCCATGGCCATTGGCCTGGGG - Intergenic
1061391723 9:130320615-130320637 GCGTCCTGGACAATGTCCTGGGG + Intronic
1062277554 9:135737934-135737956 GAGCACTGGCCAAGGCCCTGGGG + Intronic
1186254352 X:7702857-7702879 GGGCCCTGGCAAATGTGGTGGGG + Intergenic
1189479348 X:41380983-41381005 GCCCCCAGGGCCATGTCCTGGGG - Intergenic
1190235485 X:48611894-48611916 GCTCCATCGCCAGTGTCCTGTGG + Intergenic
1190287373 X:48970472-48970494 GGGGCCTGGGCAATGTTCTGAGG + Exonic
1194848566 X:98842905-98842927 TTGCCCAGACCAATGTCCTGGGG + Intergenic
1200284355 X:154805758-154805780 GTGCCCTGGCCAAATTCGTGGGG + Intronic
1202093553 Y:21219735-21219757 TTGCCCAGACCAATGTCCTGAGG - Intergenic