ID: 1072697406

View in Genome Browser
Species Human (GRCh38)
Location 10:97614073-97614095
Sequence TGTATTACAGATGAGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072697406_1072697411 8 Left 1072697406 10:97614073-97614095 CCCTGAGCCTCATCTGTAATACA 0: 1
1: 1
2: 2
3: 19
4: 155
Right 1072697411 10:97614104-97614126 AATAGTACCTTCCTCCAACAAGG No data
1072697406_1072697415 24 Left 1072697406 10:97614073-97614095 CCCTGAGCCTCATCTGTAATACA 0: 1
1: 1
2: 2
3: 19
4: 155
Right 1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG No data
1072697406_1072697416 25 Left 1072697406 10:97614073-97614095 CCCTGAGCCTCATCTGTAATACA 0: 1
1: 1
2: 2
3: 19
4: 155
Right 1072697416 10:97614121-97614143 ACAAGGACGTGCATGTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072697406 Original CRISPR TGTATTACAGATGAGGCTCA GGG (reversed) Intronic
901501229 1:9653580-9653602 GGTGTTACAGAGGAGTCTCAAGG - Exonic
903489697 1:23719055-23719077 GATTTTACAGATGAGGCTCAGGG + Intergenic
903851211 1:26307202-26307224 AATTTTACAGATGAGGCTCTGGG - Intronic
904046553 1:27612737-27612759 TGTTTTACAGATGGGGCAAAAGG - Exonic
905911545 1:41658489-41658511 TGTTTTACAGATGAGGAACTCGG - Intronic
906641274 1:47442073-47442095 TGGAGAAGAGATGAGGCTCAAGG + Intergenic
907273064 1:53301978-53302000 TGTTTTACAGCTGAGGCACTGGG - Intronic
907659519 1:56378959-56378981 TATATTCCAGGTGAAGCTCATGG - Intergenic
908657435 1:66403071-66403093 TGCATTACAGAGGAAGATCAAGG - Intergenic
915062559 1:153198313-153198335 TGAATTTAAGATGAGGCCCAAGG - Intergenic
916426243 1:164683462-164683484 TGTATGACAACTGAGGCTCCAGG + Intronic
917927546 1:179801597-179801619 CGTTTTGCAGATGAGCCTCAAGG + Intronic
923399186 1:233599871-233599893 TGAAGTGCAGCTGAGGCTCAAGG - Intergenic
923439136 1:233999005-233999027 TGTATTGAGCATGAGGCTCAAGG - Intronic
1063760713 10:9072178-9072200 TGTATAATAGCTGTGGCTCAGGG - Intergenic
1064216864 10:13407815-13407837 CATTTTACAGATGAGGCTCCTGG - Intergenic
1069049822 10:63780689-63780711 TGCATGACAGATGAGGATTATGG - Intergenic
1071501024 10:86204490-86204512 TGTAGGACAGGTGGGGCTCAGGG + Intronic
1072697406 10:97614073-97614095 TGTATTACAGATGAGGCTCAGGG - Intronic
1073789574 10:106927104-106927126 AGTATTACATTAGAGGCTCAAGG - Intronic
1074996506 10:118761336-118761358 GGTATTACAGGTGTGGCCCATGG + Intergenic
1079967444 11:26995612-26995634 TGTTTTTCAAATGAGGTTCAAGG + Exonic
1080776428 11:35391371-35391393 TGTTTTACCAATGAGGCTCTGGG + Intronic
1082200330 11:49358666-49358688 TGTATTACAAATGATGATAATGG + Intergenic
1085197842 11:74683162-74683184 CATTTTACAGATGAGGCCCAGGG - Intergenic
1086655340 11:89347541-89347563 TGTATTACAAATGATGATAATGG - Intronic
1087167188 11:95016647-95016669 TGTACTTCACATGAGACTCAGGG - Intergenic
1088600676 11:111471900-111471922 TGTGTAACAGATGAGTTTCAAGG - Intronic
1090420548 11:126572377-126572399 TGCTGTACAGGTGAGGCTCAGGG + Intronic
1091121209 11:133059208-133059230 TATCTTACAGATAAAGCTCAAGG + Intronic
1091324913 11:134678884-134678906 AGGATTACAGATGAGGCCAAGGG - Intergenic
1092927063 12:13280836-13280858 TTTATTACAGATGAGGCTCTAGG - Intergenic
1094768493 12:33625419-33625441 TCTATCCCAGATGAGGCTAATGG + Intergenic
1096552360 12:52381287-52381309 TATATAACAGATCAGGCCCAGGG - Intronic
1101775235 12:107787524-107787546 TGTGTTAGAGATGGGGGTCAGGG - Intergenic
1101796418 12:107978858-107978880 TGTGCTACAGATGAGGCTCTGGG + Intergenic
1101821084 12:108184646-108184668 TGTTTTACAGATGAGGAACCCGG - Intronic
1101829798 12:108248489-108248511 TGCATGACAGAGGAGGCTCAAGG + Exonic
1102806721 12:115787903-115787925 TATTTTACAGATGAGGCTACTGG - Intergenic
1103017323 12:117505510-117505532 TGTTTTACAGATCAGACTCCAGG - Intronic
1104031770 12:125069923-125069945 TGTATGACAGATGCAGCTGACGG + Intronic
1105002770 12:132702144-132702166 TGAATTACAGCTGAGCCTGAAGG + Intronic
1106363422 13:29053269-29053291 TGCTTTACAGATGAGGCTCAGGG + Intronic
1106970960 13:35141109-35141131 TGTAATACAGATGTGGACCAAGG + Intronic
1108605763 13:52036982-52037004 TGTATTACTGATGAAGACCAAGG - Intronic
1111010413 13:82306046-82306068 TGTGTTAGAGGTAAGGCTCATGG - Intergenic
1111022672 13:82474163-82474185 TGTATTAGTGGTGAGGCTCAAGG + Intergenic
1112462670 13:99616576-99616598 TGTAGTTCAGAAGAGGTTCATGG - Intronic
1114714202 14:24807400-24807422 AGGATTCCAGATGAGGCTCAAGG + Intergenic
1114714206 14:24807424-24807446 AGAATTCCAGATGAGGCTCAAGG + Intergenic
1114714210 14:24807448-24807470 AGAATTCCAGATGAGGCTCAAGG + Intergenic
1117959697 14:61150503-61150525 CATTTCACAGATGAGGCTCAAGG + Intergenic
1121948430 14:98146229-98146251 TCTATTAAACATGAGTCTCAAGG - Intergenic
1123854674 15:24396180-24396202 TTTCTTACAGGTGAGGTTCACGG + Intergenic
1126230188 15:46314840-46314862 AGTATTATAGATGAAGCCCAAGG + Intergenic
1126877595 15:53060907-53060929 CATTTTACAGTTGAGGCTCAGGG - Intergenic
1127014068 15:54663824-54663846 TGGATTACAGATGAGAGGCATGG + Intergenic
1127983063 15:64048118-64048140 GGTATTAAGCATGAGGCTCAAGG - Intronic
1129032491 15:72629161-72629183 GGTTTCACTGATGAGGCTCAGGG - Intergenic
1129217400 15:74108078-74108100 GGTTTCACTGATGAGGCTCAGGG + Intronic
1129264045 15:74384504-74384526 TGTACTACAGCTGAAGCTCCAGG + Intergenic
1129407257 15:75327909-75327931 GGTTTCACTGATGAGGCTCAGGG - Intergenic
1129734559 15:77952365-77952387 GGTTTCACTGATGAGGCTCAGGG + Intergenic
1129841031 15:78743626-78743648 GGTTTCACTGATGAGGCTCAGGG - Intergenic
1130156803 15:81357518-81357540 CATTTTACAGATGAGGCTCAGGG + Intronic
1135244217 16:20841011-20841033 TACATTACAGAGTAGGCTCATGG + Intronic
1137712864 16:50578884-50578906 GTTTTTAAAGATGAGGCTCATGG - Intronic
1138112274 16:54333534-54333556 AGTATTAGAGATAAGGATCAAGG - Intergenic
1144287848 17:13795788-13795810 TGAATTACAGATGAGAAACAAGG + Intergenic
1146196444 17:30817135-30817157 TGTATTAAAAATGAGGCTGTGGG + Intronic
1147701446 17:42398183-42398205 TATAATACAGATGTGGCTGAAGG - Intergenic
1151879453 17:76886385-76886407 TGTGTTAGAGATGATGCTGATGG + Intronic
1151952003 17:77359976-77359998 TGTAGTACAGATGGGGCTGTTGG - Intronic
1158379728 18:56915956-56915978 TGGATTACTGAGGAGGCTGACGG - Intronic
1159859663 18:73632075-73632097 TGTTTTACAGATGATGTTCAGGG + Intergenic
1159944389 18:74433100-74433122 TGTGTTACAGCTGAAGCTGATGG - Intergenic
1160143145 18:76343844-76343866 TGAATTACATATGAGGATAATGG + Intergenic
1162474442 19:10891545-10891567 TGGGTCACAGAAGAGGCTCAGGG + Intronic
1165646898 19:37447477-37447499 TGTACTACAGAAGAGGTTTATGG + Intronic
1166842558 19:45707175-45707197 TGTTGTACAGATGAGGCTGCTGG + Intergenic
1168439998 19:56356481-56356503 GGGAGTATAGATGAGGCTCATGG + Intronic
925113287 2:1354287-1354309 CACTTTACAGATGAGGCTCAGGG - Intronic
925113311 2:1354393-1354415 CACTTTACAGATGAGGCTCAGGG - Intronic
925452479 2:3981539-3981561 TGCATTCCAGATGGGGCTCCCGG + Intergenic
926058250 2:9789352-9789374 GGTCTGAAAGATGAGGCTCAGGG - Intergenic
929667611 2:43845404-43845426 TGTTTTACAGATGAGGCTCAGGG - Intronic
930378607 2:50598378-50598400 TTTTTTATAGAGGAGGCTCAAGG - Intronic
931879866 2:66557172-66557194 CATACGACAGATGAGGCTCAGGG + Intronic
933250781 2:80026063-80026085 TGTAATTCAGATGAGGTTCTTGG + Intronic
934567632 2:95349362-95349384 TCTATTACAGATGAGAACCACGG - Intronic
936590931 2:113803594-113803616 TGTATAAGAAATGAGGCACAGGG + Intergenic
939716714 2:145592924-145592946 GGTATTAGAGAAGAGGCTGATGG + Intergenic
942383897 2:175421388-175421410 TGTCCTACAGATGAGCCACAAGG - Intergenic
943705581 2:191030471-191030493 TATATTATTGATGAGGCTCCGGG + Intronic
945179644 2:207078735-207078757 TTTAATACAGCTGAGGTTCAAGG + Exonic
946965113 2:225029038-225029060 TGTATTACAGATGGTGCACTGGG + Intronic
1169253415 20:4078579-4078601 TGGGTTAAAGAGGAGGCTCATGG - Intergenic
1169769005 20:9181272-9181294 TGTCTGTCAGATGAGGCTCAGGG + Intronic
1171057289 20:21919796-21919818 TGTAGAAAACATGAGGCTCAGGG + Intergenic
1173574782 20:44105563-44105585 TATATTTCTGATGAGGCTCAGGG + Intergenic
1176242233 20:64080381-64080403 AGTTTTACAGACGCGGCTCACGG - Intronic
1180735755 22:18015683-18015705 TGGATTAGAGATGAGTCTTAGGG - Intronic
1183235256 22:36611941-36611963 CGGTTTACAGAGGAGGCTCAGGG - Intronic
1183709534 22:39494739-39494761 TGTGTTACAGATGAGGACCCAGG - Intergenic
1184933888 22:47704579-47704601 TGGTTTACAGATGAGGCTTCAGG + Intergenic
953726487 3:45403686-45403708 GATGTTACAGAGGAGGCTCAAGG + Intronic
955737210 3:62052142-62052164 TATATTGCAGATGAGACTTATGG - Intronic
956135877 3:66098283-66098305 TGTCTTTCAAATGAGGCTCAAGG + Intergenic
958966557 3:100564828-100564850 GGAATTAGAGATGTGGCTCAAGG + Intronic
960265074 3:115611905-115611927 CGTAGTAAAGATGAGACTCAAGG + Intergenic
965652719 3:170950370-170950392 TTTAATACAGCTGAGGTTCAAGG + Intergenic
967230042 3:187329078-187329100 TGTATTAGAGATGACTTTCAAGG - Intergenic
972037432 4:34544017-34544039 TCTATTAAAGATGAGACTCTGGG + Intergenic
972254666 4:37340390-37340412 TGAATAATAAATGAGGCTCAGGG - Intronic
973825491 4:54701274-54701296 TGACTTGCAGATGGGGCTCATGG + Intronic
973974193 4:56245962-56245984 TATAAAACAGATGAGGCACACGG - Intronic
977080832 4:92525447-92525469 TTTAGGACAGATGAGTCTCATGG - Intronic
977287244 4:95123458-95123480 TTTATTACAGACGCAGCTCATGG - Intronic
978758836 4:112333140-112333162 TGTATTAAAGCTGAAGCTAAAGG + Intronic
979268630 4:118732965-118732987 AGTCTTACAGATGAAGCTCAGGG - Intronic
981585553 4:146298148-146298170 TATATCACAGATGAGGCACACGG - Intronic
986546811 5:8906594-8906616 TATTTTACAGATGAGGGTCTTGG - Intergenic
987784818 5:22486403-22486425 TGAATTACAGATGAAGCAAAAGG + Intronic
990799638 5:59586017-59586039 TTTTTTAAAGATGAGGCTTAGGG - Intronic
991637936 5:68724873-68724895 TTTTATACACATGAGGCTCAGGG + Intergenic
995109969 5:108418147-108418169 TGTGTTACAGCTCTGGCTCAGGG - Intergenic
995504078 5:112840677-112840699 AGAAGTACAGATGAGGCTCAAGG + Exonic
998770214 5:145535082-145535104 TGTATTACAAATATGGCTCCTGG - Intronic
998901323 5:146858130-146858152 TATTTTACAGATGAGGCACCTGG + Intronic
999400393 5:151259615-151259637 AGTCTCATAGATGAGGCTCAGGG + Intronic
1000408795 5:160916786-160916808 CTGATTACAGCTGAGGCTCAAGG + Intergenic
1001514211 5:172343935-172343957 TGTTTTATAGATGAGACTCAGGG - Intronic
1005267161 6:24124382-24124404 TGTATCAGAGATTAGGCTCCAGG - Intergenic
1010373518 6:75139409-75139431 TACATTAAAGATGATGCTCAAGG + Intronic
1012635339 6:101531627-101531649 TGTATTACAGATAAGCCAAATGG + Intronic
1012777470 6:103516196-103516218 TAGATTACAGATGTGACTCATGG + Intergenic
1013792929 6:113856844-113856866 GGTTTTACAGATAATGCTCAGGG - Intergenic
1014274379 6:119370104-119370126 GGTATAACAGATTTGGCTCAGGG - Intergenic
1014844049 6:126254136-126254158 TGTACTAAAGATGATGCTGAAGG - Intergenic
1016437756 6:144055410-144055432 TATTATACAGATGAGGCTTATGG + Intronic
1016563986 6:145431181-145431203 TGTTTTACAGACCAGGGTCAAGG + Intergenic
1016669839 6:146691269-146691291 GTTATAACAGATGAAGCTCAAGG + Exonic
1019577408 7:1744161-1744183 TGTTTTACAGAAGAGATTCAGGG + Intronic
1020004478 7:4775052-4775074 TGTTTTACAGATGAGGCCACAGG - Intronic
1021045024 7:15912268-15912290 GGTGTTAAAGATGAGGCTGAAGG + Intergenic
1024587421 7:50854017-50854039 TGTATTACAGAAGAATCTCCTGG - Intergenic
1024709031 7:51995259-51995281 TGAAATACAAATGAGGCACATGG - Intergenic
1026101475 7:67387978-67388000 TGTATTAGAGGTCAGCCTCATGG + Intergenic
1027532862 7:79357038-79357060 GGTATTATAAATGATGCTCAAGG + Intronic
1029743222 7:102503023-102503045 AGTCTTACAGAGGAGGCCCAGGG - Intronic
1029761211 7:102602184-102602206 AGTCTTACAGAGGAGGCCCAGGG - Intronic
1031938716 7:127764466-127764488 TGTATTGCAGATGCTGCTGAAGG + Intronic
1033178597 7:139151556-139151578 TGTTTTACAGATGATGCTTAAGG - Intronic
1033722233 7:144074045-144074067 TGCATTACAAATGAAGCACAAGG - Intergenic
1033804302 7:144937181-144937203 TGTCTTGAAGAAGAGGCTCATGG + Intergenic
1034966546 7:155394923-155394945 TGCATGCGAGATGAGGCTCAGGG + Intronic
1035224213 7:157424717-157424739 TGTTTTAGAGACAAGGCTCACGG - Intergenic
1037094019 8:14961397-14961419 TGTATTACAGTAGATTCTCATGG + Intronic
1040893398 8:52340187-52340209 TTTCTTAGAGTTGAGGCTCAGGG - Intronic
1042687529 8:71458975-71458997 TTTATTACAGTGGCGGCTCATGG + Intronic
1046849242 8:118953572-118953594 TATCTTATAGATGAGGCTCAGGG - Intergenic
1047182901 8:122606082-122606104 TGTTTTACGGGTGAGGCTAAAGG + Intergenic
1047913832 8:129560385-129560407 TGTCTTACAGATGAGGGACCTGG - Intergenic
1048627602 8:136202894-136202916 TTTATTACAGTTGATGCTCCCGG + Intergenic
1048675522 8:136774628-136774650 TCTATGACAGATGAGGATAATGG + Intergenic
1048818905 8:138361361-138361383 TCAATTACAGATGAGTCACATGG - Intronic
1057875641 9:98752196-98752218 TGTTTTACAGAAGATGGTCACGG + Intronic
1058240410 9:102550810-102550832 TGTCATACAGATGCTGCTCAAGG + Intergenic
1059494407 9:114697599-114697621 TGTTTTGTAGATGTGGCTCAAGG + Intergenic
1060425136 9:123498307-123498329 TGTCTTACTGAGGAGGCTCAGGG + Intronic
1060662961 9:125415073-125415095 TGTATTACAGATGAGGTGGCCGG - Intergenic
1203784286 EBV:118719-118741 TGTCTCACAGATGAGTATCATGG + Intergenic
1185952266 X:4450308-4450330 TGTTTTTCACTTGAGGCTCAGGG + Intergenic
1187672298 X:21680243-21680265 GGTATTAAAGATGATGCTTAAGG + Intergenic
1189233691 X:39471623-39471645 TATATTACACATCAGGCCCATGG - Intergenic
1193804721 X:85981640-85981662 TGTGTTACAGGTGAAGCTTAGGG + Intronic
1202354779 Y:24035048-24035070 GAAATTACAGATGAGGCTCGAGG + Intergenic
1202515999 Y:25635061-25635083 GAAATTACAGATGAGGCTCGAGG - Intergenic