ID: 1072697410

View in Genome Browser
Species Human (GRCh38)
Location 10:97614080-97614102
Sequence TTATCCCTGTATTACAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5236
Summary {0: 1, 1: 32, 2: 192, 3: 1159, 4: 3852}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072697410_1072697420 30 Left 1072697410 10:97614080-97614102 CCTCATCTGTAATACAGGGATAA 0: 1
1: 32
2: 192
3: 1159
4: 3852
Right 1072697420 10:97614133-97614155 ATGTAAAAGGGTTAGCGTGGGGG No data
1072697410_1072697415 17 Left 1072697410 10:97614080-97614102 CCTCATCTGTAATACAGGGATAA 0: 1
1: 32
2: 192
3: 1159
4: 3852
Right 1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG No data
1072697410_1072697411 1 Left 1072697410 10:97614080-97614102 CCTCATCTGTAATACAGGGATAA 0: 1
1: 32
2: 192
3: 1159
4: 3852
Right 1072697411 10:97614104-97614126 AATAGTACCTTCCTCCAACAAGG No data
1072697410_1072697417 27 Left 1072697410 10:97614080-97614102 CCTCATCTGTAATACAGGGATAA 0: 1
1: 32
2: 192
3: 1159
4: 3852
Right 1072697417 10:97614130-97614152 TGCATGTAAAAGGGTTAGCGTGG No data
1072697410_1072697419 29 Left 1072697410 10:97614080-97614102 CCTCATCTGTAATACAGGGATAA 0: 1
1: 32
2: 192
3: 1159
4: 3852
Right 1072697419 10:97614132-97614154 CATGTAAAAGGGTTAGCGTGGGG No data
1072697410_1072697418 28 Left 1072697410 10:97614080-97614102 CCTCATCTGTAATACAGGGATAA 0: 1
1: 32
2: 192
3: 1159
4: 3852
Right 1072697418 10:97614131-97614153 GCATGTAAAAGGGTTAGCGTGGG No data
1072697410_1072697416 18 Left 1072697410 10:97614080-97614102 CCTCATCTGTAATACAGGGATAA 0: 1
1: 32
2: 192
3: 1159
4: 3852
Right 1072697416 10:97614121-97614143 ACAAGGACGTGCATGTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072697410 Original CRISPR TTATCCCTGTATTACAGATG AGG (reversed) Intronic
Too many off-targets to display for this crispr