ID: 1072697415

View in Genome Browser
Species Human (GRCh38)
Location 10:97614120-97614142
Sequence AACAAGGACGTGCATGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072697406_1072697415 24 Left 1072697406 10:97614073-97614095 CCCTGAGCCTCATCTGTAATACA 0: 1
1: 1
2: 2
3: 19
4: 155
Right 1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG No data
1072697410_1072697415 17 Left 1072697410 10:97614080-97614102 CCTCATCTGTAATACAGGGATAA 0: 1
1: 32
2: 192
3: 1159
4: 3852
Right 1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG No data
1072697407_1072697415 23 Left 1072697407 10:97614074-97614096 CCTGAGCCTCATCTGTAATACAG 0: 1
1: 0
2: 3
3: 24
4: 196
Right 1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072697415 Original CRISPR AACAAGGACGTGCATGTAAA AGG Intronic
No off target data available for this crispr