ID: 1072697857

View in Genome Browser
Species Human (GRCh38)
Location 10:97617374-97617396
Sequence GGATGCTACAAGAGTAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072697857 Original CRISPR GGATGCTACAAGAGTAAGAA GGG (reversed) Intronic
902146449 1:14404816-14404838 GTATTGTAAAAGAGTAAGAAAGG + Intergenic
904155077 1:28476279-28476301 GAAAGCTATCAGAGTAAGAAAGG + Exonic
907719638 1:56959791-56959813 GGAAGCTAGTAGAGTGAGAAAGG + Intronic
907793648 1:57692907-57692929 GGTTGGTACAAGAGTTTGAAAGG - Intronic
907904963 1:58776184-58776206 GGAAACTACAAGAGTATGGATGG + Intergenic
910165026 1:84317998-84318020 TGATGCTACAGAAGTAAAAAAGG - Intronic
912204734 1:107497010-107497032 GGAGGCTACTAGAATAAGAATGG - Intergenic
921462470 1:215445085-215445107 GGAAGCTACAATATGAAGAAGGG + Intergenic
922458770 1:225798653-225798675 GGATGCTCCCAGTGTAAGAAAGG - Intergenic
924202813 1:241677569-241677591 CCATGCCACAAGAGTATGAAAGG + Intronic
1063056724 10:2513126-2513148 AGAAGCTACACAAGTAAGAAGGG + Intergenic
1065342485 10:24721530-24721552 GGATGCTACAAGCCTGAGAATGG - Intronic
1065798572 10:29330133-29330155 GGATGCTACAATAATAAGAGGGG - Intergenic
1068436168 10:56993899-56993921 CTATGTTACAACAGTAAGAAAGG + Intergenic
1068825307 10:61431320-61431342 GGATACTGCAATACTAAGAATGG + Exonic
1069386301 10:67885441-67885463 ATATGCTAAAAGAGTAAGAGGGG - Intronic
1070376195 10:75833239-75833261 GACTGGTACAAGAGAAAGAAGGG + Intronic
1072697857 10:97617374-97617396 GGATGCTACAAGAGTAAGAAGGG - Intronic
1074020416 10:109576787-109576809 GGATCCTACATGAGGAAGAAAGG + Intergenic
1075469393 10:122676738-122676760 GGGTGCTACAAGAGGAGAAACGG - Intergenic
1079854870 11:25590144-25590166 TGATGCTACAAGGGTTAGCAAGG - Intergenic
1080374531 11:31692884-31692906 GGATGCTACCAGAGCATAAACGG - Intronic
1080997475 11:37621243-37621265 GGATGGTACCAGACTTAGAAGGG - Intergenic
1081091831 11:38879585-38879607 TGATGATTCAAGAGAAAGAAAGG - Intergenic
1081422532 11:42887907-42887929 GAATGAGACAAGAGAAAGAAGGG + Intergenic
1082057795 11:47834287-47834309 GGATGTTACATGAATAACAATGG + Intronic
1083576652 11:63796717-63796739 GCATGCTACAAGGGAATGAATGG + Intergenic
1084949231 11:72655436-72655458 GGATGGTACAAGAGCCAAAATGG + Intronic
1087379404 11:97385573-97385595 TGAAGATAAAAGAGTAAGAAAGG + Intergenic
1088263026 11:107962605-107962627 GTATGCTAACAAAGTAAGAATGG - Exonic
1090566050 11:127993298-127993320 GGAGTCAACAAGAGAAAGAAAGG + Intergenic
1091141752 11:133241185-133241207 GGATGTTACAAGAGTTAAAGAGG - Intronic
1094360200 12:29622214-29622236 GTATGCTACAAGATTATAAAAGG + Intronic
1094435358 12:30415106-30415128 GGATGATGCAGGAGAAAGAATGG - Intergenic
1096881049 12:54671131-54671153 GGAGGAAACAAGAGTGAGAAAGG - Intergenic
1096950869 12:55469478-55469500 TGATGATGTAAGAGTAAGAAAGG + Exonic
1097317381 12:58186567-58186589 GGATTCTCCAAAAATAAGAAAGG - Intergenic
1098100992 12:67017310-67017332 GGATGCTTTAAGAGTAAAAGGGG - Intergenic
1098796162 12:74890519-74890541 GGATACTAAAAGAATATGAAGGG - Intergenic
1099691784 12:85963911-85963933 GGATACTTCAAGAGTAAAATGGG + Exonic
1099985808 12:89662389-89662411 AGATACTACAAGATTAAGAATGG + Intronic
1100396246 12:94188702-94188724 GGATGATACAGGAGAGAGAAGGG + Intronic
1107177507 13:37416134-37416156 GGATGGGACAAGGGTAGGAAAGG + Intergenic
1108809164 13:54200027-54200049 GGTTGCTAAAAGAGTAATGAGGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1110142718 13:72150629-72150651 GGAAGCTAAATGAGGAAGAAAGG + Intergenic
1114437654 14:22721264-22721286 GGATCCTATTAGGGTAAGAATGG - Intergenic
1115895577 14:38083092-38083114 TCATGCTACAATAGTAATAATGG - Intergenic
1117213716 14:53528142-53528164 GTATGCTACAAGAGTAAGCAGGG + Intergenic
1118150388 14:63182726-63182748 GGAGGCTACAAGCCAAAGAATGG - Intergenic
1120003359 14:79328998-79329020 GGAAGTAACATGAGTAAGAAAGG + Intronic
1121906580 14:97751673-97751695 GGAAGCAACACGAGTAAGGAAGG + Exonic
1135339097 16:21630865-21630887 GGTTGGTACAAGAGTTTGAAAGG + Intronic
1135399507 16:22156430-22156452 GGATGCTGCAAGAGAAAGACTGG - Exonic
1135637368 16:24089938-24089960 GGTTGTTACAAGAGTAAAATTGG - Intronic
1137709756 16:50558365-50558387 GGATTCTACAAGAGAATGCATGG - Intronic
1145070377 17:19800494-19800516 GGCTGCTACAGGGGTGAGAAAGG + Intronic
1145972113 17:28962351-28962373 GGATGCTACAATAGGAGTAAAGG - Intronic
1147401722 17:40184309-40184331 GGCTGCTTCAAGAGGAAGAGGGG + Exonic
1149324374 17:55515169-55515191 AGATGCTAGAAAAGTGAGAAAGG + Intergenic
1149329726 17:55568297-55568319 GGAGGTTAAAAGAATAAGAAGGG + Intergenic
1151352916 17:73542338-73542360 GGGTGCTACAAGAGAGAGCAGGG + Intronic
1151505944 17:74527150-74527172 GGATGTGGCAAGAGTAACAAAGG + Intronic
1154999650 18:21674008-21674030 GGATGCTGCAGTGGTAAGAATGG + Intronic
1156901255 18:42302595-42302617 GGAAGCTAGAAGAGAAACAAGGG + Intergenic
1158670767 18:59471765-59471787 GGAGGCTGGAAGAGGAAGAAAGG + Intronic
1160036004 18:75302366-75302388 GGATGCTACAAGTGTGATCAAGG - Intergenic
1161077918 19:2295345-2295367 GGAAGCTGGAAGAGTCAGAAAGG + Intronic
1163497971 19:17657637-17657659 GGATGCTATAGGAATAAAAAGGG + Intronic
1166287309 19:41839179-41839201 GGATGCTATAAGACCCAGAAAGG - Intronic
927818179 2:26239327-26239349 GGATACTAAAAGAGGAAGACTGG + Intronic
927979343 2:27364321-27364343 AGATGCTAAAAGAGAAACAAAGG + Intergenic
930161739 2:48165508-48165530 GAAAGCAACAAGAGTTAGAAGGG - Intergenic
932380553 2:71277735-71277757 GGATGTTCCAAGAGTCACAAGGG + Intronic
933478982 2:82830571-82830593 GTATGCTCCAGGAGTATGAAAGG - Intergenic
935975366 2:108573083-108573105 GGATGCTAGAAAAATAAAAAAGG + Intronic
936252063 2:110874628-110874650 GGTTGCTAAAATAGTAATAATGG + Intronic
943151182 2:184115625-184115647 AGAGGCAACAAGGGTAAGAAAGG + Intergenic
944775255 2:202957350-202957372 GGATGATACCAGATTATGAAAGG - Intronic
945716228 2:213360618-213360640 GTATGCTACAACAGAAAGAAAGG - Intronic
948355304 2:237372897-237372919 GGGTGACACAAGAGCAAGAAAGG + Intronic
1170344093 20:15364214-15364236 GAATGCAGCAAGAGTAAGAAAGG - Intronic
1170487111 20:16829596-16829618 GGATGGTACAAGATTGATAAGGG - Intergenic
1170634337 20:18091900-18091922 GGCTCCTGCAAAAGTAAGAAAGG - Intergenic
1170877657 20:20265913-20265935 TGATGCTGCAAGAATAATAATGG - Intronic
1171183329 20:23107200-23107222 TGATGCTATAAGAGTAAAAATGG + Intergenic
1172039624 20:32034830-32034852 GGATGCTACAGGAGGAAGTGTGG - Intergenic
1175365967 20:58456427-58456449 GGAGGCTCCAAAACTAAGAAAGG + Intergenic
1177603028 21:23339847-23339869 AGATAGTACAAGAGTCAGAAAGG - Intergenic
1178249417 21:30987619-30987641 GGATTCTAGAAGAGTAAAATGGG + Intergenic
952564916 3:34643384-34643406 GGATACTAAAAGGGTAATAAAGG + Intergenic
954962584 3:54579366-54579388 TGAGGTTACAAGAGAAAGAACGG - Intronic
955014245 3:55052739-55052761 GAATACTACAAGTGTAAAAAGGG - Intronic
955489804 3:59470874-59470896 GGCTGTTACAAGAGAAAGTAAGG + Intergenic
956053874 3:65277910-65277932 GGATGCTGCAACAGTAGCAATGG + Intergenic
958995981 3:100905455-100905477 GGCTAATACATGAGTAAGAAAGG - Intronic
959384536 3:105685837-105685859 TGATGCTACAATAATAAGCATGG + Intronic
959393963 3:105812673-105812695 TGAAGATACAAAAGTAAGAAGGG + Intronic
959395034 3:105826594-105826616 GAATGGTACAAGAGGATGAAAGG - Intronic
959921105 3:111869352-111869374 GGATGCTACAGGAGGGAAAAGGG - Intronic
960501392 3:118443174-118443196 GGATGCTAGAATCTTAAGAACGG - Intergenic
960520382 3:118647664-118647686 GGAAGGTAGAAGAGGAAGAAAGG + Intergenic
961545951 3:127633325-127633347 GGATGCTCCAGGAAGAAGAATGG - Intronic
962246394 3:133797917-133797939 GCATGCTAGAAGAGGGAGAAGGG + Intronic
964182651 3:153906876-153906898 GGATGCTAGAAGAGTCTGCAAGG + Intergenic
967673936 3:192273275-192273297 GGAAGCTAAAACAGTAGGAATGG - Intronic
969588864 4:8109884-8109906 GGATTCAACCAGAGTGAGAAAGG - Intronic
969887141 4:10225123-10225145 GGGTGTTAAAAGAGGAAGAAAGG - Intergenic
970620228 4:17810620-17810642 CGATCCTCCAAGAGTGAGAACGG - Exonic
975537008 4:75461423-75461445 GGATTCCACAAAAGGAAGAAAGG - Intergenic
976411814 4:84721990-84722012 GAAAGCTATAATAGTAAGAATGG + Intronic
976886634 4:89992579-89992601 TGGAGATACAAGAGTAAGAAAGG + Intergenic
977348453 4:95847835-95847857 GGAATCTACAATAGAAAGAATGG - Intergenic
978247396 4:106590645-106590667 GGTTGGTACAAGAGTAATAGCGG - Intergenic
980094916 4:128479678-128479700 GGTTTCTACAAGGGTAATAATGG - Intergenic
981945099 4:150332367-150332389 TGTTGCTACAAGAGCAAAAAGGG - Intronic
982637034 4:157909821-157909843 ACATGCTATAAGTGTAAGAAAGG - Intergenic
983170644 4:164531937-164531959 GGATGAGACCAGAGAAAGAACGG - Intergenic
984827404 4:183938838-183938860 GGATGCTACAAGTGCAAGGCTGG - Intronic
987418941 5:17695306-17695328 GAATGCAACAAGAGAAAAAAAGG + Intergenic
988718705 5:33854518-33854540 GGATGGTACAGGAGAAGGAATGG - Intronic
993656408 5:90583501-90583523 GGTAGCTAGAAGAGTAGGAATGG - Intronic
995369417 5:111402141-111402163 GCAGGCTAGAAGAGAAAGAAGGG - Intronic
997356067 5:133263794-133263816 GTATGCTACAAGAGAGAGAAGGG + Intronic
998915485 5:147006915-147006937 GGATGGTATAAGAGTTTGAAAGG - Intronic
999070099 5:148735655-148735677 GGAAGTAACATGAGTAAGAAAGG + Intergenic
1000589491 5:163141766-163141788 GAATGCAACAATAGTAAAAAAGG - Intergenic
1006485764 6:34340192-34340214 GGATGGCAGAAGAGAAAGAAGGG + Intronic
1007943529 6:45804391-45804413 GGATGCTGGAAGAGTAAGTTAGG - Intergenic
1008669703 6:53754708-53754730 GGATGCAAGAAAAGAAAGAATGG - Intergenic
1009923848 6:70096569-70096591 GGATTCTATAAGAGAAAAAATGG + Intronic
1010678594 6:78772727-78772749 GGAAGCAACATGAGTAAAAAAGG + Intergenic
1012098961 6:95005662-95005684 GGACACTACCAGAGAAAGAATGG - Intergenic
1012631870 6:101480408-101480430 GGATGCTAAGAGAGGAAAAAGGG - Intronic
1013948785 6:115754121-115754143 GGGTGCTACCAGAGTCAGAAGGG - Intergenic
1016313613 6:142760970-142760992 TGATGCTAGAGGAGAAAGAAAGG + Intronic
1020741555 7:12025812-12025834 TGATGCTAGAAGAATGAGAATGG + Intergenic
1021644467 7:22774988-22775010 GGATGCCACATAAGGAAGAATGG + Intergenic
1022126255 7:27360433-27360455 GGAAGCAACATGAATAAGAAAGG - Intergenic
1022138030 7:27467423-27467445 TGAGGCTACAAGGGCAAGAAAGG - Intergenic
1024225171 7:47321035-47321057 CCATGCTCCAAGAGTCAGAAGGG - Intronic
1028791433 7:94857823-94857845 GGATGCTAAATGAGTAAGCATGG - Intergenic
1030502194 7:110373640-110373662 GGATGCTGCAAGCATTAGAAAGG - Intergenic
1031430258 7:121659268-121659290 GGGGGCTACAAGAGGAGGAAGGG - Intergenic
1031805640 7:126303533-126303555 GGAGGCTACAAAAGGCAGAATGG + Intergenic
1032384765 7:131514079-131514101 GGCTGCTGCCAGAGTATGAAAGG + Intronic
1032763837 7:134971788-134971810 GTATGCTCCAAGTGGAAGAATGG + Intergenic
1033454438 7:141489974-141489996 GGTTGCTACAAGTGTTAGAGTGG + Intergenic
1033677742 7:143560352-143560374 GAAAGCTAAAACAGTAAGAAAGG + Intergenic
1033694094 7:143769088-143769110 GAAAGCTAAAACAGTAAGAAAGG - Intergenic
1034000439 7:147406700-147406722 GAATGTTACATGAGTAAGAAAGG + Intronic
1034854481 7:154529189-154529211 GAAGGCTTCAAGAGGAAGAATGG + Intronic
1037590035 8:20304263-20304285 GGATGCGACAAGAGCAAGACAGG - Intergenic
1040964720 8:53072048-53072070 GGCTGGTATAAGAGTATGAAAGG + Intergenic
1045443010 8:102233738-102233760 GGATTCTACAAGGGTGAAAATGG - Intronic
1045599734 8:103699142-103699164 GGATACTAAAAGACTAATAATGG - Intronic
1047132958 8:122042359-122042381 GGATGCTACAACATATAGAATGG - Intergenic
1047636114 8:126764375-126764397 GGATACAACAAAAGAAAGAAAGG - Intergenic
1049031227 8:140039293-140039315 GAGAGCTACAAGAATAAGAAAGG + Intronic
1050060182 9:1700299-1700321 GGAAGCTATGAGAGTAGGAATGG - Intergenic
1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG + Intronic
1054758250 9:68980588-68980610 GGATAGTACAAGAGAAAGAAAGG - Intronic
1057491130 9:95520621-95520643 TGATGGTACAAGAGTAACACTGG - Intergenic
1058480580 9:105389797-105389819 GGATGCTACTAAAGTCAAAAAGG - Exonic
1058485259 9:105437152-105437174 AAATGCTGCAAGAATAAGAATGG + Intronic
1061741261 9:132708177-132708199 GGATGCTAGAGGAAGAAGAAGGG - Intergenic
1186838778 X:13464394-13464416 TGATGTTCCAAGAGAAAGAATGG - Intergenic
1187769159 X:22676447-22676469 GGAAGTAACAGGAGTAAGAATGG + Intergenic
1189424019 X:40882096-40882118 GGATGCTAAAAAAGGAGGAAAGG + Intergenic
1189877677 X:45453845-45453867 TTATTCTACAAGAGAAAGAAGGG + Intergenic
1191027306 X:55928016-55928038 GGATTCCAAAAGAGTAAAAAAGG - Intergenic
1191849354 X:65574614-65574636 GGGTGCTGCAAGGGGAAGAAGGG - Intergenic
1194347445 X:92783760-92783782 GGGTCCTACAAGAGGATGAAGGG + Intergenic
1195461642 X:105133057-105133079 GGATGCTATAAAAGAAACAACGG - Intronic
1196412248 X:115432656-115432678 GGATGCCACAAGAGAAGGGAAGG - Intergenic
1196627189 X:117889955-117889977 TGCTAGTACAAGAGTAAGAAAGG - Intergenic
1197656725 X:129124892-129124914 GGATGATACAACAGAAAGACAGG - Intergenic
1200351918 X:155506034-155506056 ACATGCTAGAAGAGTAAGAAGGG + Intronic
1200655768 Y:5900393-5900415 GGGTCCTACAAGAGGATGAAGGG + Intergenic
1201911766 Y:19139923-19139945 GGTTGCTATAAGAGTTTGAAAGG - Intergenic