ID: 1072701763

View in Genome Browser
Species Human (GRCh38)
Location 10:97647066-97647088
Sequence GGAACCTGAGCCCAGCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072701763_1072701766 -7 Left 1072701763 10:97647066-97647088 CCACTGCGCTGGGCTCAGGTTCC 0: 1
1: 0
2: 0
3: 26
4: 282
Right 1072701766 10:97647082-97647104 AGGTTCCAGTAATTGGTTGTGGG No data
1072701763_1072701768 9 Left 1072701763 10:97647066-97647088 CCACTGCGCTGGGCTCAGGTTCC 0: 1
1: 0
2: 0
3: 26
4: 282
Right 1072701768 10:97647098-97647120 TTGTGGGTTCTGACACCAGCTGG No data
1072701763_1072701769 16 Left 1072701763 10:97647066-97647088 CCACTGCGCTGGGCTCAGGTTCC 0: 1
1: 0
2: 0
3: 26
4: 282
Right 1072701769 10:97647105-97647127 TTCTGACACCAGCTGGTGCATGG No data
1072701763_1072701765 -8 Left 1072701763 10:97647066-97647088 CCACTGCGCTGGGCTCAGGTTCC 0: 1
1: 0
2: 0
3: 26
4: 282
Right 1072701765 10:97647081-97647103 CAGGTTCCAGTAATTGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072701763 Original CRISPR GGAACCTGAGCCCAGCGCAG TGG (reversed) Intronic
900242054 1:1621838-1621860 GGAGACTGAGTCCAGTGCAGAGG - Intronic
900615635 1:3564553-3564575 GCAACCTTAGACCAGCACAGTGG - Intronic
901763771 1:11487365-11487387 GGCAGCTGAGCCCAGCTCTGGGG + Intronic
902542482 1:17164914-17164936 GGCTCCTGAGCCGAGCCCAGGGG + Intergenic
902637751 1:17745956-17745978 GGATCCTGCTCCCAGCACAGTGG + Intergenic
902938311 1:19780689-19780711 GGTAGCTGAGCCCACTGCAGAGG - Exonic
903051619 1:20605370-20605392 GGAACCTGAGCCAGGCGCGGTGG + Intronic
903803607 1:25988525-25988547 GGAAGCTAAGCCAGGCGCAGTGG + Intronic
903828022 1:26159133-26159155 GTACCCTGAGCCCAGGGCTGGGG + Intronic
903898302 1:26623264-26623286 AGAACCTGAGCCTGGCGCGGTGG - Intergenic
904138821 1:28335533-28335555 GGAAACCGGGCCAAGCGCAGTGG + Exonic
904289513 1:29475224-29475246 GAAACATCAGCCCAGGGCAGGGG + Intergenic
904697089 1:32336684-32336706 GGGTGCCGAGCCCAGCGCAGGGG - Intergenic
905091998 1:35437188-35437210 GGAGCCTGAGCTCAGCACATCGG - Intronic
905777801 1:40681011-40681033 GGACCCTGAGCACAGGTCAGGGG - Intergenic
907395842 1:54189439-54189461 GGAGGCTGAGACCAGGGCAGGGG + Intronic
907944074 1:59117053-59117075 GGAACAAGAGCCCAGCCCAATGG + Intergenic
917928423 1:179807533-179807555 GAAGCCTGTGCCCAGGGCAGCGG - Intronic
918071620 1:181137475-181137497 GGAACCTGGGGTCGGCGCAGGGG - Intergenic
919923492 1:202179950-202179972 GGTACCTGAGCCTGGCACAGTGG - Intergenic
920134429 1:203758149-203758171 GGAACTTAGGCCCAGCGCAGTGG + Intergenic
920285224 1:204874229-204874251 TTAACCTGAGCCAAGCCCAGCGG - Intronic
921075228 1:211695203-211695225 GTCACCTGAGCCTAGCTCAGTGG + Intergenic
922732098 1:227954018-227954040 GGAGGCTGAGCCCAGCCCAGGGG + Intergenic
922852712 1:228747556-228747578 GGCAGCTGACCCCAGCCCAGAGG + Intergenic
923473483 1:234312532-234312554 GCAACCTGAGCCCAGCATGGGGG + Intronic
924741265 1:246795395-246795417 GGAGGCTGAGCCCAGGGCAGGGG - Intergenic
1062805464 10:416397-416419 GAAACCTGAGCCCGGGGCTGTGG - Intronic
1062838469 10:651349-651371 GGGACCTGAGCACAGTGCTGGGG - Exonic
1063362197 10:5467901-5467923 GGAACCTAAGACCAGAGCATGGG - Intergenic
1063457579 10:6195157-6195179 GGAACAGGAGGCGAGCGCAGTGG - Intronic
1064651825 10:17517162-17517184 GCAATCTGGGGCCAGCGCAGGGG + Intergenic
1065291671 10:24236529-24236551 GAAACATGAGCCTAGCGCAGTGG - Intronic
1066399446 10:35061184-35061206 ATAAACTGAGCCGAGCGCAGTGG + Intronic
1066535441 10:36386046-36386068 GAAACCGGGGCCCTGCGCAGTGG + Intergenic
1067271568 10:44796102-44796124 GCAACATGAGCACAGCGGAGGGG + Intergenic
1068459584 10:57309965-57309987 GAAATCTGGGCCCAGGGCAGTGG - Intergenic
1069703882 10:70444992-70445014 GGAACCTGAGTCCTGGTCAGAGG - Intronic
1069913879 10:71775418-71775440 GGGAACTGGGCCCAGCTCAGAGG - Intronic
1070157408 10:73843953-73843975 GGCTCCTGAGCCAAGGGCAGGGG - Intronic
1070651501 10:78240182-78240204 GGAACCTCAGCCCAGTGTAGTGG + Intergenic
1070659356 10:78293607-78293629 GAATCCTGAGACCAGGGCAGAGG - Intergenic
1070814418 10:79313887-79313909 GAAACCAGAGCCCAGGGCAATGG + Exonic
1070898854 10:80010088-80010110 GGAATCTGGGCCCAGTGCAGTGG + Intergenic
1071455626 10:85849478-85849500 GGAGGCTGAGCCAAGGGCAGTGG + Intronic
1071618101 10:87094701-87094723 GGACGCCGAGCCCAGGGCAGCGG + Exonic
1072701763 10:97647066-97647088 GGAACCTGAGCCCAGCGCAGTGG - Intronic
1073564708 10:104525282-104525304 GGAACTGGAGCCCAGTGCTGGGG + Intergenic
1074766076 10:116700911-116700933 GGGACCTGGGCCCAGGGGAGAGG + Intronic
1076362235 10:129897368-129897390 GGAACCAGAGCAGAGCCCAGCGG + Intronic
1076532679 10:131155194-131155216 GACACCTGAGCCCAGGGCAAGGG - Intronic
1076538050 10:131195625-131195647 GGAGCCTGGGCCCAGCGGAGAGG - Intronic
1076761238 10:132606764-132606786 GGAGGCTGAGACCAGGGCAGGGG + Intronic
1077154704 11:1086089-1086111 GAAGCCTGAGCCCAGGCCAGGGG + Intergenic
1077178329 11:1200630-1200652 GGAACCCGAGCCCAGCCAGGAGG + Intronic
1080658672 11:34278088-34278110 AGAATCTGAGCCAGGCGCAGTGG - Intronic
1081812726 11:45922619-45922641 GAAACCTGAGCCCAGGTCGGGGG + Intronic
1081820281 11:45987091-45987113 GTAACCTGGGCCAAGCACAGTGG + Intronic
1083786464 11:64951475-64951497 AGAAACTGTGGCCAGCGCAGTGG + Intronic
1084007461 11:66330998-66331020 GCAACCTGGGGACAGCGCAGGGG - Intronic
1084088519 11:66865735-66865757 GGAGTCTGAGCCAAGCTCAGGGG - Intronic
1084203459 11:67577288-67577310 GGGGCCTGAGCTCAGCCCAGGGG + Intergenic
1084980786 11:72827438-72827460 GGGAGCTGAGCCCAGCCGAGAGG - Intronic
1085220294 11:74868204-74868226 GAATGTTGAGCCCAGCGCAGTGG - Intronic
1085386911 11:76162776-76162798 GGAACCACAGGCCAGGGCAGCGG - Intergenic
1088284969 11:108178568-108178590 GGAATCTGGGCCCAGTGCAGTGG + Intronic
1089386358 11:118070811-118070833 GGAACCTGAGTCCTTCCCAGAGG + Intergenic
1089679228 11:120110124-120110146 GGAACCAGCACCCAGGGCAGGGG + Intergenic
1091753312 12:3036044-3036066 GGAGACTGAGGCCAGCTCAGGGG + Intronic
1091970105 12:4779753-4779775 GGCCCCTGAGCCCACTGCAGCGG - Intronic
1092101439 12:5887400-5887422 GGCCCCTGAGCCCAGCCCTGGGG + Intronic
1093470027 12:19490751-19490773 AAAACCTGAGCCGAGCACAGTGG - Intronic
1094370200 12:29729441-29729463 GGAACCTGGCCCAAGAGCAGAGG + Intronic
1096706228 12:53424118-53424140 GGAACCTGAGCCCTGCCATGGGG - Intronic
1100130146 12:91482397-91482419 GCAACAGGAGCCCAGCTCAGGGG - Intergenic
1100843100 12:98632913-98632935 GGAATCTGAGCCAGGCGTAGTGG - Intronic
1101351744 12:103936121-103936143 GGAACCTGAGGCCGTGGCAGTGG - Intronic
1102081034 12:110098203-110098225 GGGAACTGAGCCAAGTGCAGTGG - Intergenic
1102348731 12:112176458-112176480 GAACCCAGAGCCCAGAGCAGAGG + Intronic
1103972811 12:124682579-124682601 GTACCCTGAGCCCAGCACTGGGG + Intergenic
1104593158 12:130100598-130100620 GAGACCTCAGCCCAGCCCAGAGG + Intergenic
1104674558 12:130703867-130703889 TGAGCCTGAACGCAGCGCAGAGG + Intronic
1105708461 13:22983059-22983081 GGCAGCTGATCCCAGAGCAGAGG - Intergenic
1106863387 13:33936001-33936023 GGAAGATGAGACCAGCTCAGTGG - Intronic
1107097027 13:36548161-36548183 GGAACCTGGGGCCGGGGCAGGGG - Intergenic
1113120145 13:106917251-106917273 GGGACTTGAACCCAGCGCCGTGG - Intergenic
1113378189 13:109783168-109783190 GGTGCCTGAGCCCAGCGACGAGG + Exonic
1113637370 13:111929017-111929039 TGAAACTGTGCCCAGCTCAGAGG + Intergenic
1113660722 13:112104976-112104998 GGAGCCGGAGCGCAGCGGAGGGG + Intergenic
1113896607 13:113768540-113768562 GGCACCTGAGCCAGGCACAGAGG - Intronic
1113968997 13:114174199-114174221 CGAACCTGAGGCCCGTGCAGGGG - Intergenic
1118289498 14:64506243-64506265 GGAAACTGGGCCGGGCGCAGTGG + Intronic
1119005587 14:70924671-70924693 GTCACCTGAGCCCAGAGAAGTGG - Intronic
1119241394 14:73063107-73063129 GGAACCTGGGCCAGGTGCAGTGG - Intronic
1120818722 14:88891931-88891953 GCACCCTGAGCCCAGTGAAGGGG - Intergenic
1121384101 14:93501400-93501422 GTAACATGTGGCCAGCGCAGTGG + Intronic
1121619712 14:95337624-95337646 TGAACCTGAGCCCAGCACCCAGG - Intergenic
1122361644 14:101170652-101170674 GGAAAAAGAGCCCAGCACAGCGG + Intergenic
1122383550 14:101328253-101328275 TGAACCTGGGCCGGGCGCAGTGG - Intergenic
1125581263 15:40787669-40787691 GCAACCTGAACCCAGAGCAGGGG + Intronic
1125700586 15:41679329-41679351 GAAACCTCGGCCCAGCGCGGTGG - Intronic
1126845319 15:52754722-52754744 GTAACATGAGCCAGGCGCAGTGG + Intergenic
1127260251 15:57322264-57322286 GTAACCTGATCCCAGCCCAACGG + Intergenic
1129227548 15:74178858-74178880 GGAACCTGAGCTTGGGGCAGGGG + Intergenic
1129353190 15:74969555-74969577 GCAACCTTGGCCCAGAGCAGTGG - Intronic
1132031167 15:98439472-98439494 AGAGCCTGAGCCCACCTCAGAGG + Exonic
1132724109 16:1331461-1331483 GGAAACTGAGGCCCGGGCAGTGG + Intergenic
1132882506 16:2168649-2168671 GGAACCTGCGCCAAGTGCTGGGG + Intronic
1132996857 16:2827957-2827979 GGAAGCAGAGCCCAGGCCAGGGG - Intergenic
1133175441 16:4010845-4010867 GGCGCCTGATCCCATCGCAGGGG - Intronic
1133188837 16:4118377-4118399 GGAAGCTGGGCCCTGTGCAGTGG + Intergenic
1133303247 16:4795664-4795686 GGATCCTGGGCTCAGCTCAGCGG - Intronic
1133313437 16:4866797-4866819 GGAACCTTGGCCCGGCGCGGTGG - Intronic
1136402848 16:30028002-30028024 GGAACCTGAGACTGGTGCAGTGG + Intronic
1138382235 16:56610671-56610693 GCAACCTGAGCCAAGGGCATGGG + Intergenic
1138488139 16:57359918-57359940 GGATAGTGAGCCCAGAGCAGTGG - Intronic
1139517918 16:67462673-67462695 ACAAAATGAGCCCAGCGCAGTGG + Intronic
1141230792 16:82165409-82165431 GGGACCTGGGCCGGGCGCAGCGG - Intronic
1143282556 17:5765752-5765774 GGAACCTGGGCTGAGCGCAGTGG - Intergenic
1143311526 17:5995081-5995103 GGAGCCGGAGCCCAGCGTGGGGG + Intronic
1144027062 17:11286672-11286694 GGAACCAGATCCCAGTTCAGAGG + Intronic
1144166286 17:12614035-12614057 GGACCTTGAGCCCAGAGGAGTGG - Intergenic
1144573368 17:16414791-16414813 GGAACCAGGGCCGGGCGCAGTGG - Intergenic
1144703437 17:17352805-17352827 GGAGCCGCAGCCCAGGGCAGAGG + Intergenic
1146085338 17:29823393-29823415 GGAACATTAGCCCAGTGCAAGGG - Intronic
1146668359 17:34719932-34719954 GGAAACTGAGGCCAGGGCTGGGG - Intergenic
1147140376 17:38457295-38457317 GGCTCCAGAGCCCAGCCCAGAGG - Intronic
1147313183 17:39606819-39606841 GGAGCCGGGGCCCAGCGCCGGGG - Intronic
1147949382 17:44098449-44098471 GGAACCTGGGCCAGGCGCAGTGG + Intronic
1149684022 17:58525213-58525235 GGAAACTGAGGCCAGGGCAAGGG + Intronic
1151826802 17:76528366-76528388 GGATGCTGACCCCAGCGCGGCGG - Exonic
1151865547 17:76799659-76799681 GAACCATGAGCCCAGCGCAGTGG - Intergenic
1151972775 17:77467421-77467443 GGGCCCTGAGCCCAGCACTGGGG + Intronic
1152382491 17:79949293-79949315 GGGAGCTGAGCACAGCCCAGGGG + Intronic
1152441559 17:80312958-80312980 GGAACCTGAGTCCACAGCCGAGG + Intronic
1152637842 17:81437468-81437490 GGCACCAGAACCCAGCCCAGGGG - Intronic
1152843524 17:82585585-82585607 GGAAACTGGGCCGGGCGCAGTGG - Intronic
1155321862 18:24627229-24627251 GGCACCTGAGCCCTGGCCAGAGG + Intergenic
1156445648 18:37235062-37235084 GGAACAAGAGCCCAGTGAAGTGG + Intergenic
1161008298 19:1947537-1947559 GGAGCCTGAGGGCAGCGCACGGG + Intronic
1161521806 19:4728711-4728733 GGAACATGGGCTCGGCGCAGTGG - Intergenic
1162091051 19:8280437-8280459 GGAGCAGGAGCCCAGGGCAGGGG + Intronic
1162093285 19:8295275-8295297 GGAGCAGGAGCCCAGGGCAGGGG + Intronic
1162423467 19:10579639-10579661 CGACCCTGGGCCCAGCGCAGTGG - Intronic
1162612431 19:11767065-11767087 GAACCCGGAGCCCAGTGCAGGGG - Intronic
1163018015 19:14468586-14468608 GGAACCTGACCCTAAAGCAGAGG - Intronic
1163612626 19:18309165-18309187 GGCACCTGAGCCCAGCACACAGG + Intronic
1163970183 19:20785912-20785934 TGAAAATGAGCCCAGCACAGTGG - Intronic
1164872971 19:31662089-31662111 AAAACCTGAGCCGAGTGCAGTGG + Intergenic
1165013319 19:32864070-32864092 AGTACCTGAGCCCAGGGCAGGGG - Intronic
1165169795 19:33883956-33883978 GGATGCTGAGCCCAGGGCTGAGG + Intergenic
1166126328 19:40717255-40717277 GCGACCTGGGCCCGGCGCAGGGG + Exonic
1166337585 19:42117556-42117578 GGAAACTGAGGCCAGAGGAGTGG - Intronic
1167141871 19:47657146-47657168 AGAACATGGGCCCGGCGCAGTGG - Intronic
1167255920 19:48428648-48428670 GGAACTTGGGCCGGGCGCAGTGG - Intronic
1167283493 19:48585378-48585400 TGAACCTCAGCCGGGCGCAGTGG + Intronic
925380614 2:3422949-3422971 GAAAACTGTGCCCGGCGCAGTGG + Intronic
928515991 2:32045430-32045452 GGAAACTGAGCCAAGCACAGTGG + Intergenic
929074955 2:38073602-38073624 GCTAACTGAGCCAAGCGCAGGGG + Intronic
929128185 2:38539533-38539555 GGAACCTGAGCATACCGCAGAGG + Intergenic
929366022 2:41157627-41157649 GTAACCTTAGCCAAGCACAGTGG + Intergenic
930062560 2:47302504-47302526 GGAACCATGGCCAAGCGCAGTGG + Intergenic
931835297 2:66092723-66092745 GAAACATCAGCCCAGCACAGTGG + Intergenic
933650864 2:84849167-84849189 GCAGCCTGAGCCCAGAGCAGAGG - Intronic
933824874 2:86150224-86150246 GGAACCTGAAGCCAAGGCAGAGG + Intronic
933992553 2:87643924-87643946 GGAGGCTGTGCCCAGCACAGTGG - Intergenic
935668588 2:105535934-105535956 TGTGCCTGTGCCCAGCGCAGTGG + Intergenic
935698103 2:105787199-105787221 GGAAGCTCAGCTCAGCGCCGTGG + Intronic
935734538 2:106096487-106096509 GAAAACAGAGCCCAGAGCAGGGG + Intronic
936019910 2:108987062-108987084 GGAAACTGAGCCCAGCTGAGGGG + Intronic
936301300 2:111306917-111306939 GGAGGCTGTGCCCAGCACAGTGG + Intergenic
937143791 2:119625093-119625115 GCTACCTGAGCCCAGAGCTGTGG - Intronic
937200883 2:120203945-120203967 GGAACCTTGGCTCAGTGCAGTGG - Intergenic
937318999 2:120949544-120949566 GGATCCTGAGCCAAGAGAAGGGG + Intronic
937915751 2:127097924-127097946 AGAACCTGAGCCAAGTTCAGAGG - Intronic
938980208 2:136519217-136519239 GGAGCCTGGGCGCAGCTCAGGGG + Intergenic
941112272 2:161428107-161428129 TGCACCCGAGCCCAGAGCAGCGG + Intronic
947742945 2:232493127-232493149 GGCACGTGACCCCAGAGCAGGGG + Intergenic
947972095 2:234333130-234333152 GGAACTTCAGCCCAACGAAGGGG + Intergenic
948466173 2:238152711-238152733 GGAACAAGAGCCCAGAGCTGAGG + Exonic
948797487 2:240412356-240412378 GGAATCCGAGCCCAGGGCGGCGG + Intergenic
948826081 2:240573993-240574015 GGAAGCGGAGCTCACCGCAGGGG + Intronic
1168786271 20:543190-543212 GGAAGCTCAGCCCCGCCCAGAGG + Intronic
1169088387 20:2841019-2841041 GGAAACTGAGGCAAGCACAGTGG + Intronic
1169228054 20:3868345-3868367 GCAACATGGGCCGAGCGCAGTGG + Exonic
1170112791 20:12823449-12823471 GGAACCTGAGCCCAGAAAAACGG + Intergenic
1172122286 20:32605556-32605578 GAAACCTCAGCCCAGCGAGGTGG - Intronic
1172688405 20:36774147-36774169 GGAACCAGAGCCTAGCGACGGGG - Intergenic
1172982271 20:38952361-38952383 GGGACCTGATACCAGCGAAGTGG - Exonic
1174136775 20:48385310-48385332 GAAACCTGAGCCCAGAGGAATGG + Intergenic
1174956809 20:55106520-55106542 GGACCCTGAGCCCAGTATAGTGG - Intergenic
1175252560 20:57618239-57618261 GGAACCTGAGGGCAGTGCATGGG + Intronic
1175912411 20:62411141-62411163 GAAACCGGTGCCCAGAGCAGGGG + Intronic
1176706343 21:10122028-10122050 GACACCTGGGCCCAGCGCAAGGG - Intergenic
1178713526 21:34942478-34942500 TGTACCTGAGCTCAGAGCAGAGG - Intronic
1178914550 21:36699274-36699296 GGAGCGGGAGCCCAGCGGAGGGG - Exonic
1179804807 21:43830502-43830524 GGAAGCTGATCCCACCGCTGGGG - Intergenic
1180681295 22:17628717-17628739 GGAACCCGAGATCTGCGCAGGGG - Exonic
1180744053 22:18074908-18074930 AGAATCTCAGCCCAGCGCGGTGG - Intergenic
1182354465 22:29716214-29716236 GAAAACTGAGACCAGGGCAGGGG + Intergenic
1182485965 22:30638977-30638999 AGAAGTTCAGCCCAGCGCAGTGG + Intronic
1183191694 22:36325686-36325708 GGAACCTGACCCCGGCACGGTGG - Intronic
1183502415 22:38188844-38188866 GGGACCTCAGCCCAGCTCAGGGG + Intronic
1184186329 22:42867657-42867679 GGCATCAGAGCCCAGAGCAGAGG + Intronic
1184505058 22:44895525-44895547 GGAAGCAGTGCCCAGCACAGTGG - Intronic
1184686415 22:46098355-46098377 GAGACCTGGGCCCAGCTCAGGGG - Intronic
1184730487 22:46368743-46368765 GGAACAGGGGCCCAGCACAGAGG - Intronic
1185382838 22:50518056-50518078 GGGATCTGAGCCCAGCGACGGGG + Intronic
949935427 3:9112189-9112211 GGACCCTGATCCCAGGGCAGTGG - Intronic
953651266 3:44807029-44807051 AGAACTTGAGGCCAGCGCAGTGG - Intronic
956728910 3:72178579-72178601 GGAGCCTGTGACCAGGGCAGGGG - Intergenic
956815246 3:72902547-72902569 GCAAGCTGAGCCGAGTGCAGTGG + Intronic
961035561 3:123639244-123639266 GGCACATGCGCCCAGCGCCGAGG + Intronic
961571041 3:127798926-127798948 GGAAGCTGAGGGCAGAGCAGGGG + Intronic
962855235 3:139339265-139339287 GGGACTTGGGCCCAGAGCAGTGG - Intronic
962900351 3:139756202-139756224 AGACCATTAGCCCAGCGCAGTGG - Intergenic
964118867 3:153162256-153162278 GGAACGTGCGCCCACCGCCGCGG - Exonic
965535722 3:169822172-169822194 GGAGCCTGTGCCCGGCGCTGGGG + Exonic
966474209 3:180325210-180325232 GGAACCTGAGCCTGACGCAAAGG - Intergenic
966842955 3:184104416-184104438 AGAAACTGAGCCAGGCGCAGTGG + Intronic
968136775 3:196225424-196225446 GGAACATGAGGGCAGCTCAGTGG - Intronic
968239183 3:197060419-197060441 GGAACCTGGGCCTGGCACAGTGG - Intronic
969444005 4:7233894-7233916 GGAAACTGAGACCAGAGAAGGGG - Intronic
969532288 4:7736692-7736714 GGAATGTGTGCCCAGCCCAGTGG + Intronic
971754934 4:30695402-30695424 CTAACCTGGGCCCAGTGCAGTGG + Intergenic
976398487 4:84582861-84582883 GGAACCGCAGTGCAGCGCAGAGG + Intergenic
980856670 4:138448885-138448907 GGATACTTAGCCGAGCGCAGTGG - Intergenic
983129036 4:163991841-163991863 GGAACCTGTCCCCAGAGCCGAGG - Intronic
983573252 4:169232959-169232981 GTAAACTGGGCCAAGCGCAGTGG + Intronic
985761627 5:1751998-1752020 GGGACCCCAGCCCAGGGCAGTGG + Intergenic
988739910 5:34059914-34059936 AGGACCTGAGCCCAGAGCAGTGG - Intronic
992457699 5:76931190-76931212 GTCACCTGAGCCCAGGGAAGTGG - Intergenic
997627296 5:135339758-135339780 GGATCCTGAGCCGAGAGCAATGG + Intronic
999616612 5:153431842-153431864 GGAACATGGGCCCAGGACAGGGG - Intergenic
1001450731 5:171822394-171822416 GTCCCCTGAGCCCAGGGCAGGGG + Intergenic
1001591651 5:172869495-172869517 GGGACCTGAGCCCAGCCGAGGGG - Intronic
1002284253 5:178151741-178151763 GGCACCTGACCCCATGGCAGTGG - Intronic
1002385102 5:178860411-178860433 GGACCCCGAGCGCAGGGCAGAGG + Intronic
1002395088 5:178946411-178946433 GGCAGCTGAGCCCCGCCCAGAGG + Exonic
1002598900 5:180342612-180342634 ACAACCAGAGGCCAGCGCAGTGG + Intronic
1004903341 6:20212934-20212956 GGAAACTATGCCTAGCGCAGAGG - Intergenic
1005826367 6:29633412-29633434 GGAACCCGAGCCAAAGGCAGAGG + Intronic
1005881102 6:30061606-30061628 GTATCCTGAGCCCCGGGCAGAGG - Exonic
1006743747 6:36326864-36326886 GGCAGCAGAGCCCAGAGCAGGGG + Intronic
1007103070 6:39264083-39264105 GTCACCTGAGGCCAGCGCGGTGG + Intergenic
1007421673 6:41723542-41723564 GGAAACTGAGCCCGGCCCTGGGG - Intronic
1009708823 6:67291039-67291061 GGCACCTGAGCCAGGCACAGTGG + Intergenic
1013123344 6:107159703-107159725 GGGAGCTTGGCCCAGCGCAGTGG - Intronic
1015635657 6:135271498-135271520 TGCAGCTGAGCCCAGGGCAGAGG + Intergenic
1016825886 6:148388200-148388222 AGAACCTGGGCCGGGCGCAGGGG - Intronic
1019143596 6:169962920-169962942 GGTGGCTGAGCCCAGAGCAGCGG - Intergenic
1020129718 7:5552950-5552972 GCGACCTGAGTCCAGCGCAGAGG + Intronic
1020281950 7:6654418-6654440 CGAACCCGAGCCCGGCGCTGCGG - Exonic
1022101706 7:27173119-27173141 GGGAGCTGAGGCCAGCGCCGAGG + Intronic
1022248468 7:28583963-28583985 GGAGGCTGTGCCCAGCGCGGTGG - Intronic
1023836120 7:44068189-44068211 GCATCCAGGGCCCAGCGCAGGGG - Intronic
1024181910 7:46904407-46904429 GAAACCTGAGCCAGGTGCAGTGG + Intergenic
1024267335 7:47616870-47616892 GAAATCTTGGCCCAGCGCAGTGG + Intergenic
1025004889 7:55345578-55345600 GGTAACGGAGTCCAGCGCAGGGG - Intergenic
1025993076 7:66510797-66510819 AGAACCTCAGCCAGGCGCAGTGG - Intergenic
1026036667 7:66834615-66834637 AGAACCTCAGCCAGGCGCAGTGG + Intergenic
1026037735 7:66841482-66841504 AGAACCTCAGCCAGGCGCAGTGG + Intergenic
1026166195 7:67911873-67911895 GTAACCTGAGCCAGGTGCAGTGG - Intergenic
1029143417 7:98428507-98428529 GGAGCCTGAGCTGAGCCCAGTGG - Intergenic
1029364380 7:100107585-100107607 GGAACCTGAGCCGGGGGCCGAGG + Exonic
1032195118 7:129784206-129784228 GCAACCTGGGCCGGGCGCAGTGG + Intergenic
1033214514 7:139483677-139483699 CGCACCTGGGCCCAGTGCAGAGG + Exonic
1033317030 7:140305897-140305919 CGAACCTCAGCCCAGTTCAGTGG - Intronic
1034457492 7:151178927-151178949 GCTACTTGAGCCCAGTGCAGAGG - Intronic
1034783059 7:153899308-153899330 GGAAGCTGAGCCCAGCTCCCAGG + Intronic
1034872892 7:154699562-154699584 AGCAGCTGAGCCCAGTGCAGGGG + Intronic
1036558749 8:9883919-9883941 GGCACCTGAGCCCAGCCCCTGGG - Intergenic
1036596579 8:10218430-10218452 GGAACCAGGGCCGGGCGCAGTGG - Intronic
1036632208 8:10523897-10523919 GGGACCTGAGCCCAAAGGAGGGG + Intergenic
1036914147 8:12788159-12788181 GTAAGGTGGGCCCAGCGCAGTGG - Intergenic
1039685064 8:39792628-39792650 AGATCCTGAGCTCAGAGCAGTGG + Intronic
1040570635 8:48606053-48606075 GGCACCTGAGGGCAGGGCAGGGG - Intergenic
1042671329 8:71266722-71266744 GGAAGGTGAGCCCAGGGCACTGG - Intronic
1046439464 8:114239035-114239057 GGAACCTTGGCCGGGCGCAGTGG - Intergenic
1047228247 8:122974650-122974672 GGGACGTAGGCCCAGCGCAGTGG + Intergenic
1047230656 8:122995480-122995502 TTAACCTGAGCCCAGAGGAGAGG - Intergenic
1047300494 8:123609677-123609699 GGAACCTGGGCCCAGAGCTTAGG + Intergenic
1047505562 8:125476888-125476910 GGAGACAGAGCCCAGCCCAGGGG + Intergenic
1048995517 8:139791638-139791660 GGCACCAGAGCCCAGCGCCTGGG - Intronic
1050222685 9:3411776-3411798 GGAACAAGAGGCCTGCGCAGTGG - Intronic
1052758244 9:32563992-32564014 GGACCCAGAGCTCAGAGCAGTGG - Intronic
1053643631 9:40109147-40109169 GTCACCTGGGCCCAGCGCAAGGG - Intergenic
1053762522 9:41356344-41356366 GTCACCTGGGCCCAGCGCAAGGG + Intergenic
1054541120 9:66267458-66267480 GTCACCTGGGCCCAGCGCAAGGG + Intergenic
1055421256 9:76145388-76145410 GATACGTGAGCCCAGAGCAGCGG + Intronic
1056659675 9:88534896-88534918 GGGATGTGGGCCCAGCGCAGTGG + Intergenic
1056676660 9:88682057-88682079 GGAAACTGAGGCCAGGGCTGGGG + Intergenic
1057691575 9:97291140-97291162 GGCACCTGAGCCCTGCCCTGGGG - Intergenic
1060295216 9:122338680-122338702 AGAACCTGAGCCCGGAGCGGTGG - Intergenic
1060301405 9:122376477-122376499 GGAGACTGAGACCAGGGCAGGGG + Intronic
1060656390 9:125375262-125375284 GTGACCTGAGCCCAGCCCACAGG + Intergenic
1060772426 9:126342263-126342285 GGAGCTTGAGCCCAAGGCAGGGG + Intronic
1060897176 9:127225314-127225336 GGAACCGGAGCCCGGCGGGGTGG + Intronic
1060968256 9:127723585-127723607 GGGCGCTGAGCCCAGCTCAGTGG + Intronic
1061550035 9:131329068-131329090 GGGATCTGGGCCCAGGGCAGTGG - Intergenic
1062385849 9:136311261-136311283 GGGACCTGAGCCCAGAGGCGGGG + Intergenic
1202791381 9_KI270719v1_random:92117-92139 GTCACCTGGGCCCAGCGCAAGGG - Intergenic
1192360129 X:70434110-70434132 GGACCCTGCGCGCAGCCCAGAGG - Intergenic
1192772630 X:74208443-74208465 GTAACCTGGGCTCAGTGCAGTGG + Intergenic
1193083306 X:77426369-77426391 AGAACCTGAGGCCAACGCTGAGG + Intergenic
1193794217 X:85853333-85853355 GGACCCTGAGCATAGCTCAGAGG - Intergenic
1194468940 X:94268563-94268585 GGCACCTCGGCCCAGTGCAGTGG + Intergenic
1195377172 X:104239132-104239154 GGAATTTCAGCCCAGCCCAGAGG + Intergenic
1195474411 X:105268472-105268494 GTATGCTGAGGCCAGCGCAGTGG + Intronic