ID: 1072701767

View in Genome Browser
Species Human (GRCh38)
Location 10:97647087-97647109
Sequence CAGAACCCACAACCAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072701767_1072701772 20 Left 1072701767 10:97647087-97647109 CCAGTAATTGGTTGTGGGTTCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1072701772 10:97647130-97647152 TCTTGCTTTCTTGTGTGATTTGG No data
1072701767_1072701769 -5 Left 1072701767 10:97647087-97647109 CCAGTAATTGGTTGTGGGTTCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1072701769 10:97647105-97647127 TTCTGACACCAGCTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072701767 Original CRISPR CAGAACCCACAACCAATTAC TGG (reversed) Intronic
900362053 1:2293858-2293880 CAGAACCCACGACAGATTCCGGG - Intronic
900916474 1:5642919-5642941 CATAAACCACAAACATTTACTGG + Intergenic
901675136 1:10878864-10878886 CACACCACACTACCAATTACAGG - Intergenic
904048536 1:27623900-27623922 CAGAACACACAGCCCATTCCAGG + Exonic
915140583 1:153765489-153765511 AAAAACCCAAAACCAATAACTGG - Intronic
917850007 1:179053869-179053891 CACAACCCAGAAATAATTACAGG - Intronic
919676112 1:200385165-200385187 GAGAAGCCACATCCAATTACTGG + Intergenic
920069915 1:203295535-203295557 CGGATCCCATATCCAATTACTGG - Intergenic
920154922 1:203940785-203940807 AAGAAATCACAACAAATTACTGG + Intergenic
921150586 1:212399288-212399310 CAGATCCCACAGCCAGTAACTGG + Intronic
1064889345 10:20151927-20151949 CAAAACCCACCACCAATTTGGGG + Intronic
1067218950 10:44327769-44327791 GAGAACCCATAACCAAGTACAGG - Intergenic
1072701767 10:97647087-97647109 CAGAACCCACAACCAATTACTGG - Intronic
1074309662 10:112311399-112311421 CAGAACCCACAAACACCTGCTGG + Intergenic
1074790636 10:116883604-116883626 CTGAACACACAACCAAAAACTGG + Exonic
1074817035 10:117150151-117150173 CAGAACCCAAAACCACACACTGG - Intergenic
1082887011 11:58096168-58096190 GAGAACCAACTACCAAATACAGG + Intronic
1084408634 11:68993238-68993260 CAGAGCCCACCACCGCTTACAGG - Intergenic
1087306816 11:96499086-96499108 CAGAGCCCACCTCCACTTACAGG - Intronic
1092536258 12:9390082-9390104 CAGAGCCCACCACCGCTTACAGG - Intergenic
1096709147 12:53442731-53442753 CAGAACCCCCAAACACCTACCGG - Exonic
1098241029 12:68467319-68467341 AAGAACCCACAACTAATCAGTGG + Intergenic
1098522074 12:71443450-71443472 CAGAGCCCATAACCACTTGCTGG - Intronic
1102084143 12:110122584-110122606 CCCACCCCACAACCAATTAGGGG - Intergenic
1102742425 12:115219918-115219940 CAGCACCCACAACGTATTAGTGG + Intergenic
1106205998 13:27595190-27595212 CAGAACCCCCATCCATTTAGTGG + Intronic
1111144641 13:84164916-84164938 CAGAACTCAGAACCCATTATTGG + Intergenic
1113977493 13:114239848-114239870 CAGAACACAAAACCATTTCCTGG - Intronic
1114707940 14:24746400-24746422 CAAAACCAAAAATCAATTACAGG + Intergenic
1115488172 14:33932965-33932987 CTTAAGCCACAAACAATTACAGG + Intronic
1117506389 14:56407416-56407438 CAAAACCCTCAACAAAATACTGG + Intergenic
1119753143 14:77094964-77094986 CAGAACCCACTATCCATCACAGG + Intergenic
1122394558 14:101414367-101414389 CAGACCCCAAATCCAATGACTGG + Intergenic
1122700094 14:103582336-103582358 CAGGACCCACAGCCCGTTACAGG - Intronic
1127683066 15:61316282-61316304 CACACCCCACAACCAACAACTGG + Intergenic
1132112018 15:99108472-99108494 CAGAACCCGAAAAAAATTACAGG - Intronic
1133952274 16:10405735-10405757 CAGGACCCACTGCCACTTACAGG - Intronic
1137518473 16:49171420-49171442 GAGAGCTCACAGCCAATTACTGG - Intergenic
1139211571 16:65082908-65082930 CAGTGCCCACAGCCTATTACAGG - Intronic
1139405850 16:66717089-66717111 CAGAATCCACCCCCAATTCCTGG + Intergenic
1143900607 17:10171732-10171754 CAGGACACACAACCAATCAGAGG - Intronic
1145003568 17:19322179-19322201 CAGAACCCACAACCTTCTAGAGG - Intronic
1149368964 17:55974006-55974028 CAGAACCCACTATCTAGTACAGG + Intergenic
1149609114 17:57946752-57946774 CAAAACCCCCACCCAATTACAGG - Intronic
1151137710 17:71963480-71963502 GACAACCCACTACCAATTAAAGG - Intergenic
1152455516 17:80413937-80413959 CAGAGCCCACCAGCGATTACAGG - Intergenic
1155935450 18:31748253-31748275 AAAAACCCTCAACCAAATACTGG - Intergenic
1159196717 18:65125234-65125256 TACAACCCACAGCCAATGACCGG - Intergenic
1159239986 18:65729853-65729875 CAGAAAACACAACCAAAAACAGG + Intergenic
1159890460 18:73948541-73948563 CAGAGCCCACACCCCCTTACAGG + Intergenic
1160010785 18:75105847-75105869 CAGAACCCGGAGCCAATCACTGG - Intergenic
1163059933 19:14753310-14753332 CAGAACCCACTGCCGCTTACAGG + Intronic
1164329799 19:24243597-24243619 AAGAACCCACAAAGAATTATTGG + Intergenic
927504930 2:23606760-23606782 CAGAACCCACACTCAATGGCAGG + Intronic
930073292 2:47386176-47386198 CAGATCACACAACTAGTTACAGG - Intronic
933472827 2:82748896-82748918 CAAAAACCACAACAAAATACTGG - Intergenic
935496328 2:103786283-103786305 TTGAAACCACAACCAATTAGGGG + Intergenic
939047120 2:137262830-137262852 CAGAAACCCAAACCAATTAAAGG - Intronic
942207894 2:173640455-173640477 AACAACCCACAACTAACTACTGG - Intergenic
947270378 2:228327695-228327717 AAGAACCCACAAAGAATTATCGG - Intergenic
948713825 2:239845842-239845864 CAGAACCCAAAAGCAAGTAAGGG - Intergenic
1173136422 20:40443131-40443153 GAGAACCCAGAACCCATTCCTGG - Intergenic
1179542069 21:42089565-42089587 CAAAACCCACATCCTATAACAGG - Intronic
1182315045 22:29440118-29440140 CAGAAGCCACCACCATTTATAGG - Intronic
1182437967 22:30342757-30342779 CAGAACCAACCACCAGTAACTGG + Intronic
1183073876 22:35414235-35414257 CAAAGCCCACAGCCAATTTCTGG - Intronic
949204774 3:1424815-1424837 CAGAACCCACAGCTAACCACTGG + Intergenic
949388766 3:3536084-3536106 CAGAGCCCACCACCACTTACAGG + Intergenic
949908870 3:8883530-8883552 CAGAACCCACCAGCAAAGACTGG - Intronic
950197247 3:11017705-11017727 CAGGACCCACAGCCAACCACAGG - Intronic
952661227 3:35850199-35850221 CAGAACCCACAAAGTACTACAGG + Intergenic
954711645 3:52507888-52507910 CAGAACCCACACCCACTGACTGG + Intronic
957728403 3:84099137-84099159 CAAAACCCTCAACAAAATACTGG + Intergenic
958580284 3:96009443-96009465 CAGAACTCAGAACCAGATACAGG + Intergenic
958885364 3:99720769-99720791 CAAAAACCAGAACCAAGTACTGG + Intronic
962395487 3:135012158-135012180 CAGTACCACCAAGCAATTACTGG + Intronic
965846172 3:172964738-172964760 CAGTACACACAACTAATTAATGG + Intronic
967250031 3:187528093-187528115 CAGAACAGAGAAACAATTACTGG - Intergenic
968184066 3:196619465-196619487 CAGGAAACACAAGCAATTACAGG + Intergenic
973329797 4:48901648-48901670 TACAACCCAGATCCAATTACAGG - Intronic
979584900 4:122404139-122404161 CAGAAGCCACACCCTATGACAGG - Intronic
980934438 4:139212702-139212724 CAGAACACTAAACCAAGTACAGG + Intergenic
981557442 4:146010101-146010123 CAGAAACCATAGCCAATAACCGG - Intergenic
983010357 4:162538512-162538534 CAGAGCCCACCACCACTTACAGG + Intergenic
987241324 5:16003223-16003245 TACAACCCACATCCAATCACTGG + Intergenic
987428566 5:17802619-17802641 CAAAACACACAAACAAATACAGG - Intergenic
988044020 5:25925703-25925725 CATGACCCACAAACAATTACAGG + Intergenic
991557700 5:67914208-67914230 CAGAACCTAGAAACAATTGCAGG - Intergenic
999362054 5:150993476-150993498 CTGAACCCACTGCCACTTACAGG + Intergenic
1005426039 6:25703247-25703269 CAGAACAAACAACCATTTTCAGG + Intergenic
1008716033 6:54290995-54291017 CAGAACCCACATTCAATTTTCGG + Intergenic
1014685456 6:124493818-124493840 CAAAACCCACAACTCATGACTGG + Intronic
1017556996 6:155582552-155582574 CAGCAGCCACATCAAATTACTGG - Intergenic
1018300123 6:162393064-162393086 CAGAACAGTCACCCAATTACTGG - Intronic
1019806286 7:3128574-3128596 CCAAACCCACAATCAATTAAAGG + Intergenic
1021854196 7:24837788-24837810 CAGAACACACAACCACTGAGTGG + Intronic
1022478225 7:30725923-30725945 CCGCAGCCAAAACCAATTACCGG - Intronic
1026511867 7:71034078-71034100 CAGTTCCAACAACCAATTCCAGG - Intergenic
1027151879 7:75739028-75739050 CAGAACTCACAGCCAATGGCAGG - Intergenic
1030595876 7:111538133-111538155 CAGAACTCACAACTGATTAGGGG - Intronic
1033665998 7:143441237-143441259 CATAAACCACAAACATTTACTGG - Intergenic
1035060034 7:156062381-156062403 CAGAAAACACAGCCACTTACAGG - Intergenic
1040300202 8:46183994-46184016 AAGAACCCACAAGCAAAGACTGG - Intergenic
1042355557 8:67823911-67823933 AAGAACCCACAAAGAATTATCGG - Intergenic
1045559513 8:103247502-103247524 CAAATCACACAACCAATTAGTGG - Intergenic
1045950266 8:107843594-107843616 CAGAGCACACAAACTATTACTGG - Intergenic
1046508977 8:115174432-115174454 CAGAAGCCTCAGTCAATTACTGG - Intergenic
1048909838 8:139124777-139124799 ATGAACACACGACCAATTACAGG - Intergenic
1049261866 8:141643514-141643536 CAGAACTCACCACCAAGGACTGG - Intergenic
1051190916 9:14511635-14511657 CAGAACCCACACACTATGACTGG + Intergenic
1056982323 9:91326863-91326885 CAGAACCAAAAACAAATAACTGG + Intronic
1060976373 9:127767558-127767580 CAGAGCCCAGAACCAATGTCAGG + Intronic
1061276562 9:129572224-129572246 CAGAGCCAACAACCAGTCACAGG + Intergenic
1187803809 X:23095974-23095996 CAGACCCCACAACCACGTGCTGG + Intergenic
1188756219 X:33967877-33967899 CCACACCCACAACCAATGACTGG + Intergenic
1188772967 X:34176629-34176651 GATAACCCACATCCAATAACTGG - Intergenic
1191215209 X:57926265-57926287 CAATACCCACAAGCCATTACGGG + Intergenic
1194067557 X:89281016-89281038 CAAAATTCACAACCAAATACTGG + Intergenic
1195696711 X:107672955-107672977 CAAAACCCACCACCAATGTCTGG - Intergenic
1196412488 X:115434627-115434649 CAGTATCCACAAGCAATTGCAGG + Intergenic
1199034436 X:143033505-143033527 CAGAGCCCACTACCACTTACAGG + Intronic
1199094140 X:143720445-143720467 CAGAACCCACCGCCGCTTACAGG - Intronic
1199178675 X:144825338-144825360 CATTAACCATAACCAATTACTGG - Intergenic
1200721709 Y:6615207-6615229 CAAAATTCACAACCAAATACTGG + Intergenic