ID: 1072701769

View in Genome Browser
Species Human (GRCh38)
Location 10:97647105-97647127
Sequence TTCTGACACCAGCTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072701763_1072701769 16 Left 1072701763 10:97647066-97647088 CCACTGCGCTGGGCTCAGGTTCC 0: 1
1: 0
2: 0
3: 26
4: 282
Right 1072701769 10:97647105-97647127 TTCTGACACCAGCTGGTGCATGG No data
1072701767_1072701769 -5 Left 1072701767 10:97647087-97647109 CCAGTAATTGGTTGTGGGTTCTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1072701769 10:97647105-97647127 TTCTGACACCAGCTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072701769 Original CRISPR TTCTGACACCAGCTGGTGCA TGG Intronic
No off target data available for this crispr