ID: 1072702832

View in Genome Browser
Species Human (GRCh38)
Location 10:97656428-97656450
Sequence CATGACCCTTGATAAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072702832_1072702833 5 Left 1072702832 10:97656428-97656450 CCTCTGGCTTATCAAGGGTCATG 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1072702833 10:97656456-97656478 TAGTGACATAGTCATCCAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 102
1072702832_1072702834 15 Left 1072702832 10:97656428-97656450 CCTCTGGCTTATCAAGGGTCATG 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1072702834 10:97656466-97656488 GTCATCCAAGTGGTGAAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072702832 Original CRISPR CATGACCCTTGATAAGCCAG AGG (reversed) Intronic
904509873 1:30995591-30995613 CATGACTCTTAATAAGCCCCAGG + Intronic
905306319 1:37021223-37021245 CATGTCCCTTGGTGAGCCATGGG - Intronic
906347549 1:45028271-45028293 CATGACCTTGGGTAAGCCAATGG - Intronic
910766427 1:90787171-90787193 CATTAACATTGACAAGCCAGAGG - Intergenic
915737342 1:158093479-158093501 CATGGCCCTGGAAGAGCCAGGGG - Intronic
916384874 1:164255889-164255911 CATGCACCTGGAAAAGCCAGAGG + Intergenic
916910597 1:169341589-169341611 CATGTGCCTGGAAAAGCCAGGGG + Intronic
917195394 1:172459117-172459139 CATGACCTTGGATAAGGCAATGG + Intronic
917696763 1:177533586-177533608 CATGTGCCTTGAAAAGCCATAGG - Intergenic
919044257 1:192431027-192431049 CATGCCCCTGGAAAAGCCACAGG + Intergenic
922370986 1:224910371-224910393 CATGAGCCTAGAAAAGCCATAGG - Intronic
923351655 1:233113336-233113358 CATACACCTTGAGAAGCCAGAGG + Intronic
924936656 1:248777620-248777642 CATGAACCTGGAAAAGCCACAGG + Intergenic
1063431911 10:5998665-5998687 CCTGACCCTTGATATGCTAGAGG - Intergenic
1071832849 10:89389573-89389595 GATGACCCTGGAAAAGACAGGGG + Intronic
1072702832 10:97656428-97656450 CATGACCCTTGATAAGCCAGAGG - Intronic
1074533185 10:114310838-114310860 CATGACCTCTGAAAAGCCAGAGG - Intronic
1075375777 10:121976823-121976845 CATGACCCTTGACCAGTCACTGG - Intergenic
1077059644 11:612385-612407 CAAGACCCTTGACAGGCCAGTGG - Intergenic
1081729554 11:45360521-45360543 AGTGCCCCTTGATATGCCAGGGG + Intergenic
1083590079 11:63888637-63888659 TCTGGCCCTTGAGAAGCCAGCGG + Intronic
1090247039 11:125224004-125224026 CATGAGTCTTGAGAAGGCAGCGG + Intronic
1091311784 11:134580040-134580062 AATAACCCTTGATAGGGCAGTGG + Intergenic
1092998370 12:13972566-13972588 CATGGCCCTAAATCAGCCAGTGG - Intronic
1095125247 12:38469573-38469595 CAGGACCCTGGAAGAGCCAGTGG + Intergenic
1095850759 12:46801607-46801629 CATGACCCTTGCTCAACCAAAGG - Intronic
1101664324 12:106796615-106796637 CATGTCCCTGGATTTGCCAGTGG + Intronic
1101831298 12:108258921-108258943 CATGACACTAGAGAAGCCAAGGG + Intergenic
1102810952 12:115823821-115823843 CATGACCCAGCATAAGCCAGGGG + Intergenic
1103722559 12:122982463-122982485 CATCTCCCTTAATAAGCCTGGGG - Exonic
1105626656 13:22119671-22119693 GCTGACCCTTGATATGCCAGAGG - Intergenic
1110603796 13:77407863-77407885 CATGACCAGTGATATGCCATAGG - Intergenic
1113817891 13:113187898-113187920 CACGACCTTTGATTAGGCAGTGG - Intronic
1117100913 14:52346052-52346074 CATGACCTTGGATTTGCCAGTGG + Intergenic
1118533471 14:66732256-66732278 CATGAGCCTAGAAAAGCCACAGG + Intronic
1118890119 14:69902063-69902085 CATGACCATTCCTAAACCAGAGG - Intronic
1120564609 14:86039072-86039094 CATGAGCTTTGAGAGGCCAGGGG + Intergenic
1121471213 14:94155836-94155858 CATGTGCCTTGAAAAGCCACAGG + Intronic
1121572133 14:94954364-94954386 GATGACCCTGGATTATCCAGTGG - Intergenic
1122949594 14:105034539-105034561 CATGACACTTGCTAGGCCACAGG + Intergenic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1131805948 15:96122833-96122855 CATGATCCTTAAGGAGCCAGAGG - Intergenic
1133594653 16:7279917-7279939 TATGACCTTTGAGAAACCAGTGG + Intronic
1139027972 16:62842763-62842785 AATGACCCTGGATAATCAAGAGG + Intergenic
1140221737 16:73048541-73048563 CCTGACCTTTGATGAGCGAGGGG - Intronic
1140852421 16:78947576-78947598 GATGGCCCTTGATAAGGCAGGGG + Intronic
1140976999 16:80069447-80069469 CAAGACCTTTAATGAGCCAGCGG + Intergenic
1148802120 17:50235844-50235866 CATGGCCCATGAAAAGCCCGAGG + Intergenic
1149367667 17:55962129-55962151 AAGGACCCTGGAAAAGCCAGCGG + Intergenic
1152595785 17:81236952-81236974 CCTGACCCTTGACCACCCAGGGG + Intronic
1152801110 17:82331065-82331087 CCTGACCCTTGTCCAGCCAGGGG + Intronic
1155925658 18:31652437-31652459 CAGGAACCTAGAGAAGCCAGAGG - Intronic
1156921565 18:42528940-42528962 CATGACCCTTGACAAGGCTGTGG - Intergenic
1157630896 18:49093986-49094008 CAAGACACTTGATAAGTCATAGG - Intronic
1157809181 18:50681488-50681510 CATGACCTTGGATTAGACAGTGG - Intronic
1158299202 18:56033123-56033145 CATGAGCCTAGAAAAGCCACAGG - Intergenic
1158968582 18:62644918-62644940 CATGACCCTTGAAGCCCCAGAGG - Intergenic
1159645072 18:70908286-70908308 CCCTACCCTTGATAAGCCATAGG - Intergenic
1165474838 19:36024563-36024585 CATGTCCCTGGACAAGGCAGAGG - Exonic
1167124679 19:47541050-47541072 CATGACCTTGGATTAGACAGTGG + Intronic
930695723 2:54409970-54409992 CATGACCTTAGAGAAGGCAGAGG - Intergenic
933677665 2:85071563-85071585 CATGACCTTGGATTTGCCAGTGG - Intergenic
935426836 2:102928314-102928336 CATGGGCCTTGATGAGCCACTGG - Intergenic
936623436 2:114123611-114123633 CAGGATCCTTGATAATCCACTGG + Intergenic
940143433 2:150521227-150521249 CTGGACCTTTGGTAAGCCAGTGG - Intronic
944601603 2:201309045-201309067 CATCACCCTTGGTAAGCCCAAGG + Intronic
946503449 2:220274577-220274599 CATGCACCTTGAAAAGCAAGAGG + Intergenic
947241300 2:227997188-227997210 CATGAAACTTGATAAGCAGGGGG - Intronic
1169592879 20:7164345-7164367 CATGCGCCTTGAAAAGCCACAGG + Intergenic
1170278858 20:14623685-14623707 CATCATCCCTGAAAAGCCAGTGG + Intronic
1171252599 20:23660704-23660726 CATCACCCCTGACAAGCCAAAGG + Intergenic
1171818682 20:29812558-29812580 CTTGCACCTTGAAAAGCCAGAGG - Intergenic
1171899119 20:30840467-30840489 CTTGCACCTTGAAAAGCCAGAGG + Intergenic
1175565985 20:59977265-59977287 GTTGACCCTTGAGAATCCAGTGG + Intronic
1179225702 21:39451333-39451355 CATGAGTATTGAGAAGCCAGCGG + Intronic
1180836238 22:18930933-18930955 CATGACCCTGGAGCACCCAGTGG - Intronic
1182677673 22:32052568-32052590 CTTGACTCTTCATAAGCCTGGGG + Intronic
1184607274 22:45581392-45581414 CATGACCCTGGAGCAGTCAGGGG - Intronic
1184937749 22:47737305-47737327 CATGCCTCTTGTTAAGCCTGTGG + Intergenic
1203286330 22_KI270734v1_random:156232-156254 CATGACCCTGGAGCACCCAGTGG - Intergenic
949196593 3:1317013-1317035 CATTACCAATGATAAGCAAGAGG + Intronic
950216888 3:11166598-11166620 CATGGGCCTGGAGAAGCCAGGGG - Intronic
950216918 3:11166733-11166755 CATGGGCCTGGAGAAGCCAGGGG - Intronic
950216926 3:11166767-11166789 CATGGGCCTGGAGAAGCCAGGGG - Intronic
950216935 3:11166801-11166823 CATGGGCCTGGAGAAGCCAGGGG - Intronic
950216973 3:11166969-11166991 CATGCGCCTGGAGAAGCCAGGGG - Intronic
956517428 3:70064503-70064525 CATGACACTTGCTAAGCCCTAGG - Intergenic
956654813 3:71538750-71538772 CATGACCATGGATAAGGCAGTGG - Intronic
956695057 3:71911477-71911499 CATGACCTTAGATTAGGCAGAGG + Intergenic
957794069 3:84980274-84980296 CCTGCCCCTTGCTAAGCCTGTGG + Intronic
959043699 3:101448169-101448191 CATGACCTTGGATTAGGCAGTGG + Intronic
960969711 3:123130723-123130745 CAGGACCCATGCTAAGCCAGGGG + Intronic
963537447 3:146545425-146545447 GATGACCCTGGATAAACCAGTGG + Intergenic
964797701 3:160518030-160518052 TATGACCCTAGATTAGACAGTGG - Intronic
965290542 3:166873189-166873211 CATGTCCCTGGAAAAGCCACAGG + Intergenic
980116289 4:128682485-128682507 GTTGGCCCTTGATAAGCCACTGG + Intergenic
980599319 4:134998795-134998817 AAGGACCCTTAATAAACCAGAGG - Intergenic
985371770 4:189292601-189292623 CATGAGCCTGGAAAAGCCACAGG + Intergenic
986739461 5:10693384-10693406 CATGGCCTTTAATAAGCCACTGG + Intronic
986803627 5:11286809-11286831 CATGAACGTTGCTAAACCAGAGG - Intronic
987541831 5:19265418-19265440 CATGAATATTGATAAGCCACAGG + Intergenic
987853663 5:23389777-23389799 CATTATCCTTAATAAGCCAAGGG + Intergenic
988606785 5:32685324-32685346 CATGAGATTTGAGAAGCCAGAGG + Intergenic
993575856 5:89599725-89599747 CATGACCCTGGATTAGGCAATGG - Intergenic
993611066 5:90055100-90055122 AAAGACCCTTGATTGGCCAGGGG + Intergenic
996480866 5:123973645-123973667 CATGTGCCTGGATAAGCCACAGG - Intergenic
996585284 5:125080757-125080779 CAAGACCCTTGAAAAAACAGAGG + Intergenic
1000224302 5:159244676-159244698 CATGACCTTGGATTAGGCAGTGG - Intergenic
1003631803 6:7794195-7794217 CAAGACCCTTGATAAGTAATAGG - Intronic
1004153336 6:13142470-13142492 CATGACCCTGGATTAGGCAATGG - Intronic
1007179179 6:39915986-39916008 CATGGCCATTGCTGAGCCAGGGG - Intronic
1007662404 6:43494981-43495003 CATGGCCCATGATGAGCAAGCGG - Intronic
1010659729 6:78556097-78556119 CATGAACCTGGAAAAGCCACAGG - Intergenic
1014104271 6:117545393-117545415 CATGTTCCTTGATGAGTCAGAGG - Intronic
1014279956 6:119431167-119431189 CATGATCCTTGAAATGCCACTGG + Intergenic
1014450122 6:121572490-121572512 CATGCCCCTGGAAAAGCCACAGG + Intergenic
1016878874 6:148890331-148890353 CCTGTCCCTGGATAAGCCAGTGG - Intronic
1017811895 6:157989756-157989778 CATGTTCCTTGAGAAGCCTGGGG - Intronic
1023062888 7:36345781-36345803 CATGACCCTGGATTAGGCAATGG + Intronic
1026408486 7:70093729-70093751 AATGACCCTTGCTAACACAGAGG + Intronic
1028564891 7:92218902-92218924 CATGACCTTGGATTAGGCAGTGG - Intronic
1029274496 7:99396202-99396224 CATGACCCTCGAGGACCCAGGGG + Exonic
1030583665 7:111390261-111390283 CAGAACCCTAGACAAGCCAGTGG - Intronic
1031275105 7:119711869-119711891 CATGACGGTTAATAAGCCACAGG - Intergenic
1031626790 7:124001369-124001391 CATGAACCTGGAAAAGCCACAGG - Intergenic
1035870809 8:3134307-3134329 CATGACCCTGGATCTGCAAGAGG + Intronic
1041614579 8:59891699-59891721 CATAAACCTTGATAATTCAGTGG + Intergenic
1043260964 8:78195836-78195858 GATAACCATTGATAAGCCAGTGG - Intergenic
1045371490 8:101528845-101528867 CATGAACCTGGATAAGCTAAAGG - Intronic
1048547199 8:135398124-135398146 CAAGACAATTGTTAAGCCAGTGG - Intergenic
1059374732 9:113873255-113873277 CATGAGCTTTTATAGGCCAGAGG + Intergenic
1187032998 X:15507287-15507309 CATGACCCTGGCATAGCCAGAGG + Intronic
1188328490 X:28837731-28837753 CTTGACACTTGGTAAACCAGAGG - Intronic
1193226022 X:78985383-78985405 CATGACCCTGGAAAAGCCACAGG - Intergenic
1197893315 X:131286653-131286675 CATGACCCTGGACAGACCAGGGG - Exonic