ID: 1072705153

View in Genome Browser
Species Human (GRCh38)
Location 10:97675693-97675715
Sequence CTCTGTGATCAGAAGGAAAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 285}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072705149_1072705153 1 Left 1072705149 10:97675669-97675691 CCACATTGTCTTGATCCAGACCA 0: 1
1: 0
2: 21
3: 1244
4: 28380
Right 1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG 0: 1
1: 1
2: 3
3: 26
4: 285
1072705146_1072705153 17 Left 1072705146 10:97675653-97675675 CCTCCACACCAGATCTCCACATT 0: 1
1: 1
2: 3
3: 28
4: 303
Right 1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG 0: 1
1: 1
2: 3
3: 26
4: 285
1072705148_1072705153 9 Left 1072705148 10:97675661-97675683 CCAGATCTCCACATTGTCTTGAT 0: 1
1: 1
2: 2
3: 15
4: 185
Right 1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG 0: 1
1: 1
2: 3
3: 26
4: 285
1072705147_1072705153 14 Left 1072705147 10:97675656-97675678 CCACACCAGATCTCCACATTGTC 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG 0: 1
1: 1
2: 3
3: 26
4: 285
1072705144_1072705153 28 Left 1072705144 10:97675642-97675664 CCTGGCCACAGCCTCCACACCAG 0: 1
1: 0
2: 2
3: 69
4: 623
Right 1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG 0: 1
1: 1
2: 3
3: 26
4: 285
1072705145_1072705153 23 Left 1072705145 10:97675647-97675669 CCACAGCCTCCACACCAGATCTC 0: 1
1: 0
2: 6
3: 37
4: 454
Right 1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG 0: 1
1: 1
2: 3
3: 26
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072705153 Original CRISPR CTCTGTGATCAGAAGGAAAT TGG Exonic
901501635 1:9655999-9656021 CCCTGTGCTCAGAATGTAATAGG - Intronic
906332562 1:44899330-44899352 CTCTTTAATCAGATGGAAAGGGG - Intronic
907506756 1:54924651-54924673 CTCTTTTTTCAGAAGCAAATGGG - Intergenic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
910437938 1:87224752-87224774 CTCTGTGCTCAGAAGGGCCTTGG + Intergenic
910734675 1:90440253-90440275 TTCTGTTACCAGTAGGAAATTGG + Intergenic
912090263 1:106064511-106064533 CTCTATGATTAGCAGTAAATCGG - Intergenic
912322073 1:108723035-108723057 CTCTCTGATAAGAATGAAAATGG - Intronic
912890850 1:113528577-113528599 CTTTGAGATTAGCAGGAAATTGG + Intronic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
915379389 1:155426907-155426929 CCTGGGGATCAGAAGGAAATTGG - Intronic
915671243 1:157490685-157490707 CGCTGAGTTCAGAACGAAATAGG - Intergenic
916498161 1:165364098-165364120 CTCTGTGCACAGAAGGAAATGGG + Intergenic
917414128 1:174790647-174790669 CTCTGTGAGCAAAATGACATTGG + Intronic
918751374 1:188275012-188275034 CTCTGAGATCAAAGTGAAATAGG - Intergenic
918912820 1:190595529-190595551 CTCTGTTATGAGAAGGAATAGGG + Intergenic
919306432 1:195845236-195845258 CCCTGTGGGCAGAAAGAAATGGG - Intergenic
919780530 1:201217963-201217985 TTCTGAGATCAGAAAGAACTTGG + Intronic
920560712 1:206936523-206936545 CTCTGGGATGAGAAGGAGCTGGG + Intronic
921984415 1:221295744-221295766 ATCTGTGTTCAGAGTGAAATTGG + Intergenic
923063219 1:230495928-230495950 TTCTGGGATCAGAAGGTGATTGG + Intergenic
924209236 1:241747846-241747868 GGCAGTGATGAGAAGGAAATTGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1065156296 10:22873398-22873420 CTTGGTGATCAAATGGAAATTGG - Intergenic
1067287207 10:44915163-44915185 CTCTTTGCTCTGAGGGAAATTGG - Intronic
1067833442 10:49623283-49623305 GTCTGGGATCAGAAGGAAAGTGG - Intronic
1068202371 10:53798530-53798552 CTATGTGATAAGACAGAAATAGG + Intergenic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1073631066 10:105149655-105149677 CCCTGTGATCAGACCCAAATAGG + Intronic
1076182188 10:128418944-128418966 CTCTGGGATCAGAGGGAATGAGG + Intergenic
1076599847 10:131650444-131650466 CCCTGGGCTCAGAAGGAGATGGG + Intergenic
1077819686 11:5724857-5724879 CTCTGTGTTCCCTAGGAAATTGG - Intronic
1078433576 11:11306315-11306337 CTTGGTGATCAGAAGGATGTAGG + Intronic
1080447294 11:32349261-32349283 TTCAGTGATGAGTAGGAAATGGG + Intergenic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1083184492 11:61009246-61009268 CTCTTTGATAAGCAGGAGATGGG + Intronic
1084461269 11:69297924-69297946 CTCTGGGCTCAGAAGGTAATGGG + Intronic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086510070 11:87547222-87547244 CTCTGTAATTGGAAAGAAATGGG + Intergenic
1086749985 11:90480339-90480361 CTCTGGGGTCTGAAGGAAAGGGG - Intergenic
1086927310 11:92654341-92654363 GTGTGTGTTCAGAAGAAAATTGG - Intronic
1088120882 11:106367854-106367876 CTCTGTGTTCAGAAGAGAGTAGG + Intergenic
1088455602 11:110030034-110030056 CCTTGTGAACAAAAGGAAATGGG + Intergenic
1093329182 12:17814200-17814222 CTCTGAGATGTCAAGGAAATTGG + Intergenic
1093669524 12:21856985-21857007 CACTGTGATGAGAATCAAATGGG + Intronic
1095578210 12:43763824-43763846 CTCTGAAATCAGAAGGCCATTGG - Intronic
1095815042 12:46412072-46412094 CTCTCAAATCAGAAAGAAATGGG + Intergenic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1100456915 12:94760561-94760583 CTCAGTGACCAGAAGGGCATTGG - Intergenic
1100814966 12:98378006-98378028 CTCTGTCAGTAGAAGGACATTGG + Intergenic
1100816727 12:98394019-98394041 GTCTGTAATCAGATGGAATTGGG - Intergenic
1100961425 12:99966958-99966980 CTCTGGGATCAGAGGAAGATTGG + Intronic
1101331438 12:103761029-103761051 ATGAGTGATCAGAAGGAAAGTGG - Intronic
1103062221 12:117867770-117867792 CTCTGGGATCAGCAGTAGATTGG - Intronic
1103230282 12:119324544-119324566 CACTGTAGTCAGGAGGAAATAGG + Intergenic
1103340250 12:120217089-120217111 ATCTGTGATCAGGAGGAGCTGGG - Intronic
1103563832 12:121805592-121805614 CTCTGGGTTCGGAAGGAAAGGGG - Intronic
1106183802 13:27390421-27390443 CTCTGTGATTGAAAGGAGATAGG - Intergenic
1106632223 13:31486961-31486983 CTCTTTTATGAGGAGGAAATAGG - Intergenic
1107724593 13:43285929-43285951 ATTTCTGATGAGAAGGAAATTGG + Intronic
1108486150 13:50927941-50927963 CTTTTTGGTCAGAAGAAAATAGG - Intronic
1109728629 13:66380146-66380168 CTCTCTGATCATAAGCAATTTGG + Intronic
1111152357 13:84271656-84271678 CTCTAAGATCAAAAGGAAAATGG - Intergenic
1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG + Intronic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1112771219 13:102797008-102797030 ATCTGTGATGAAAAGGCAATGGG + Exonic
1115137842 14:30132461-30132483 TCCTCTGATCAGAAGCAAATGGG + Intronic
1115722034 14:36172890-36172912 CTCTGTGATCATAAAGTAATTGG + Intergenic
1116571447 14:46522112-46522134 CTACATGATCAGAAGGAAATAGG - Intergenic
1117188388 14:53266226-53266248 CACTGTAATTAGAATGAAATAGG - Intergenic
1117743446 14:58843197-58843219 GTCTGTGGACAGAAGGAATTGGG - Intergenic
1118387555 14:65268943-65268965 CGCTGTGATCAGAAGCAGAGTGG + Intergenic
1119327697 14:73771196-73771218 TTCTGTGATCAGATTGAAGTAGG - Intronic
1121844905 14:97164227-97164249 CTCTGACATCAGAGAGAAATGGG - Intergenic
1124449016 15:29767810-29767832 CTTTGAGACCAGAAGGAAAGAGG - Intronic
1125291565 15:38154000-38154022 CTCTGTGGTCAGAAAAAAAGAGG + Intergenic
1125753378 15:42045554-42045576 CTCTGTGCTCAGAAAGATAACGG + Intronic
1127131341 15:55867742-55867764 CTCTGTGATTTGAAGAAAAAAGG + Intronic
1127206609 15:56727167-56727189 CCCTGTTATAAGAAGGAAACTGG + Intronic
1128655952 15:69462244-69462266 CTCCGTGTCCAGAAGGAAGTGGG - Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1130757194 15:86777390-86777412 CACTGTAATAAGAAGGAAAGGGG - Intronic
1131822793 15:96290232-96290254 CTATGTGATAATAAGGAAACAGG - Intergenic
1132531342 16:451532-451554 CGCTGTGATTAGAAGGACTTAGG + Intronic
1134189660 16:12111438-12111460 CTCTGAGGTAAGAAGGAACTTGG - Intronic
1134447682 16:14343252-14343274 CTCTGTGAGCTGGAGGAAAATGG - Intergenic
1135188110 16:20332382-20332404 CTCTGTCATCAGAAAAAAAAAGG - Intergenic
1135654941 16:24239814-24239836 CTCTGCCATCAGATGGATATGGG + Intergenic
1136365752 16:29808447-29808469 ATCTTTGATCTGTAGGAAATGGG - Intronic
1136999761 16:35218202-35218224 TTCTGTGATCAGAAGAAAGAAGG - Intergenic
1137511870 16:49107721-49107743 GTGTGTGCTCAGGAGGAAATGGG - Intergenic
1138271011 16:55695863-55695885 CTCTGTGGCCATAAGGATATGGG - Intronic
1139330045 16:66181113-66181135 CTCTGAGATCAGATGGGACTAGG - Intergenic
1140080462 16:71742282-71742304 CTCTGTGATCAAAAAATAATAGG + Intronic
1140898412 16:79346457-79346479 CTCTGAAATCAGAAGAAAAAGGG + Intergenic
1141936829 16:87245562-87245584 CTCTGTGTTAAAAAAGAAATTGG - Intronic
1143910955 17:10248662-10248684 CTTTGTGATTAGAAAGAAACAGG + Intergenic
1144293901 17:13855084-13855106 CTCTCTGATCAGGTGGAATTTGG - Intergenic
1144705344 17:17364227-17364249 CTCTGGGATCTGGAAGAAATGGG - Intergenic
1146451686 17:32979561-32979583 CTCTGAACTCAGAAGGAGATCGG + Intronic
1146489767 17:33272004-33272026 CTCTGAGATGAGAATGAACTTGG - Intronic
1147529991 17:41266710-41266732 CTCTGTTTTCAGAATCAAATTGG - Intergenic
1148830389 17:50426884-50426906 CACTGAGGACAGAAGGAAATAGG - Intronic
1149141524 17:53437733-53437755 CTCTGTGATAAGAAGGAAATTGG + Intergenic
1149822850 17:59796605-59796627 CTCTGTTTTCCTAAGGAAATTGG + Intronic
1149951944 17:60997459-60997481 TTCTTTTATCATAAGGAAATGGG + Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1151943249 17:77305835-77305857 AACTGTGACCAGATGGAAATGGG - Intronic
1153112616 18:1610197-1610219 TACTGTGATCACAAGGAAAGGGG + Intergenic
1153560030 18:6362429-6362451 CTCTGTTAGCAGAAGGAGAGAGG - Intronic
1154234110 18:12587075-12587097 TTTCTTGATCAGAAGGAAATAGG - Intronic
1155160360 18:23190384-23190406 CACTGTGAGCCGAAGGAAACCGG + Intronic
1155544426 18:26900949-26900971 GGCAGTGATCAGAAGAAAATGGG - Intergenic
1156801586 18:41121454-41121476 CTCATTGATCAGAAAGAAAAGGG + Intergenic
1157173454 18:45429411-45429433 CTCTCTGAGCAGAAGCAAATTGG + Intronic
1160376267 18:78414957-78414979 CTCTGGGATGAGGTGGAAATTGG - Intergenic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1165686748 19:37828565-37828587 GTCAGTGGTCAGAAGGAAAGGGG + Intergenic
1167137410 19:47625460-47625482 CTCAGTGAAGTGAAGGAAATTGG - Intronic
1167759105 19:51433265-51433287 GGCTGTGATCAGAAAGAAATAGG - Intergenic
1168214325 19:54914123-54914145 TTCTGTGGTTAGAAGGAATTGGG - Intronic
925285297 2:2711856-2711878 CTCTGGAATCAGAAGGAATCAGG + Intergenic
926711834 2:15888275-15888297 GGCTGTGAGCAGAAGGAACTTGG + Intergenic
926952975 2:18264052-18264074 CTCTGTGTGCACCAGGAAATGGG - Intronic
927522101 2:23705184-23705206 CTCTGAGACTAGAAGTAAATGGG + Intronic
928106797 2:28475725-28475747 CTCTGTGATTAGTAGGATCTTGG - Intronic
928621252 2:33090529-33090551 CATTGTGATGAGAATGAAATGGG - Intronic
930331326 2:49988653-49988675 CTCAGTGATCAGAGGTGAATAGG - Intronic
930743851 2:54860901-54860923 CTCTGGGAGCAGAAGGGACTAGG + Intronic
931986875 2:67750783-67750805 ATTTGTGGTCAGAAGGATATTGG + Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932701263 2:73993475-73993497 CTCTATGACCAGAAGGGAATGGG + Intronic
933042405 2:77486204-77486226 CATTGTCATCAGAAGTAAATAGG + Intronic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933344041 2:81060843-81060865 CTCTGGGAGCAGAAGGGACTAGG - Intergenic
934156166 2:89203095-89203117 CTCTTAGAGAAGAAGGAAATTGG - Intergenic
934211151 2:89979668-89979690 CTCTTAGAGAAGAAGGAAATTGG + Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
934859495 2:97752025-97752047 CTCTGTCATTAGAAGTAAGTGGG + Intergenic
936415185 2:112301291-112301313 CTCTGTCATAAAAAGGAATTTGG - Intronic
937077963 2:119120821-119120843 CTCTGGGAGAAGAGGGAAATTGG + Intergenic
937610329 2:123853390-123853412 CTTTGTGGTCAGAAGGCAGTGGG + Intergenic
937832857 2:126442920-126442942 CTCTTTGAGCAGACAGAAATAGG + Intergenic
939538259 2:143460745-143460767 CTCTTTGATAAGAAGAAAATGGG + Intronic
939727551 2:145741641-145741663 CTCTTTGAAAAGAAGAAAATGGG - Intergenic
941599643 2:167525941-167525963 GACTGTGATCAAAAGGACATAGG - Intergenic
942321589 2:174741173-174741195 CTCTGTGTTAAAGAGGAAATGGG - Intergenic
942471677 2:176267420-176267442 CTATGGGATGAGGAGGAAATTGG + Intergenic
944337010 2:198545976-198545998 CTCTGTGAAATGAAGCAAATAGG - Intronic
944768142 2:202885500-202885522 CTTTGTGATCAGACAGATATAGG + Intronic
945151767 2:206799202-206799224 CTCTGGGGTCAGAAGGACTTGGG - Intergenic
947106892 2:226676870-226676892 CTGTGTGTTCAGCAGGAACTTGG - Intergenic
947738566 2:232473920-232473942 CTCTGTGAACAGAAGGGACCAGG - Intergenic
947877362 2:233476661-233476683 CTCTGTGATCAGAAGGTCCTTGG - Exonic
947890775 2:233617264-233617286 CTCTCTGTCCAGAAAGAAATTGG - Intergenic
947892387 2:233636095-233636117 CTCTCTGTCCAGAAAGAAATTGG - Intronic
1173656685 20:44704531-44704553 CTCTGTGATGAGCAGGGAATGGG + Intergenic
1174400251 20:50272157-50272179 TTCTCTGAGCAGAAGGAAGTGGG - Intergenic
1174427086 20:50439414-50439436 CTATGAGATTAGAAGGAAAATGG + Intergenic
1174748505 20:53088147-53088169 CTCTCTGTTCAGTAGGAAACAGG - Intronic
1177016915 21:15802252-15802274 GAATGTCATCAGAAGGAAATGGG + Intronic
1177918274 21:27118369-27118391 GTATGTTTTCAGAAGGAAATGGG - Intergenic
1178000213 21:28153800-28153822 TTCTGTGATCAGAAGAAGACTGG - Intergenic
1178094732 21:29202100-29202122 CATTGAGATCAGAAGGAAATGGG - Intronic
1182882331 22:33744427-33744449 CTCTGTGATGGGAATGGAATGGG + Intronic
1183250618 22:36727586-36727608 CTTTGTGATAGGAAGGCAATAGG + Intergenic
1183730405 22:39615298-39615320 CTCTTTGTTCTGAAGGCAATGGG + Intronic
1185014449 22:48334955-48334977 CTCTGTGAACTGAAGGAAAGAGG + Intergenic
949265819 3:2155282-2155304 CTCTGCAATCAGAAGGTAAGAGG - Intronic
949945879 3:9189682-9189704 GTCTGGGATCAGTAGGAAATGGG + Intronic
949993706 3:9600454-9600476 CTTTGTGATATGAAGGATATTGG + Intergenic
950936175 3:16841975-16841997 CCCAGTGGTCAGAGGGAAATGGG + Intronic
952114221 3:30159741-30159763 GTCTCTGATGAGAAGGCAATGGG + Intergenic
952120830 3:30242289-30242311 TTCTGGGAACAGAAGGAAAAGGG - Intergenic
952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG + Intergenic
952926704 3:38325693-38325715 CTCTGGGATCACATGGGAATGGG + Intergenic
953249086 3:41226944-41226966 CACTGTGGGAAGAAGGAAATTGG + Intronic
953651811 3:44812642-44812664 GTCTCTGACCAGAAGAAAATTGG - Intronic
954600232 3:51861837-51861859 GTCTGTCATCAGAATTAAATGGG - Exonic
954788614 3:53114014-53114036 TTCCCTGATGAGAAGGAAATTGG + Intronic
954960204 3:54557917-54557939 CTCAGTGATCTGAAGGAATAAGG + Intronic
955676343 3:61452863-61452885 CTCTGAGGCCAGAAGGAATTTGG - Intergenic
956571300 3:70698935-70698957 TTCTGTGCTCAGAAGAAAAATGG - Intergenic
957934162 3:86920967-86920989 CTCTGTGACCAGAATGAGATTGG + Intergenic
958954952 3:100457284-100457306 CTCTGGCATCAGAATGAACTGGG - Intergenic
960038547 3:113126269-113126291 CTCTGTGATGACAAGAAAAAGGG - Intergenic
961105168 3:124234723-124234745 CTGGGTGATCAGACAGAAATAGG - Intronic
962893419 3:139692767-139692789 CTCTGGGTACAGATGGAAATAGG + Intergenic
963066414 3:141268067-141268089 CTATGTGATCATGAGGTAATGGG - Intronic
963309524 3:143693724-143693746 CACTGTGATGAGGAGGATATTGG + Intronic
963585768 3:147186117-147186139 CTCTGTCATGAGAAGGAATTAGG - Intergenic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964931079 3:162023981-162024003 CTCTGTTATCAGAAGGACTTTGG - Intergenic
965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG + Intronic
966157796 3:176936032-176936054 CTCTGTGCTCAGCAGTGAATTGG + Intergenic
966322792 3:178719479-178719501 CCCTGTTATCAGAAGGCAGTGGG + Intronic
966462152 3:180188529-180188551 GGCTGTTATCAGAAGGAAAATGG + Intergenic
966843521 3:184107826-184107848 CTCTGTGAAAAGAAAGAAAGAGG + Intergenic
970229361 4:13892911-13892933 CTCTGTGAGCTGGAGGAAACAGG - Intergenic
971096320 4:23408803-23408825 CTGTGTGATCAGGAAGAAAATGG + Intergenic
971119988 4:23692783-23692805 CTATGTGATTAGAAAGAATTGGG - Intergenic
971798702 4:31260429-31260451 CTCTGTGGGCAGAAGGTAATGGG + Intergenic
972350159 4:38229267-38229289 CTCTGTAATCAGCAGGGACTTGG + Intergenic
972709499 4:41580330-41580352 CTCTGTGATCATGATGCAATGGG + Intronic
973745183 4:53957064-53957086 CTCTTTGCTGAGAAGGAAAGAGG - Intronic
974231564 4:59122383-59122405 CTCCCTGATCACACGGAAATGGG + Intergenic
974767860 4:66371411-66371433 GTGTGTGATCAGAAACAAATAGG + Intergenic
976278097 4:83299059-83299081 ATGTGTGATCAGAATGTAATAGG + Intronic
978074678 4:104513861-104513883 CTAAGAGAACAGAAGGAAATAGG - Intergenic
978373940 4:108055903-108055925 CTCTGTGTTAATAAAGAAATTGG - Intronic
979166299 4:117535914-117535936 CTGTGTGATCAGAAAGATTTAGG - Intergenic
980191081 4:129525998-129526020 CCCTGGGGTCAGAAGGAGATGGG + Intergenic
980762337 4:137252260-137252282 CTCAGTGAGATGAAGGAAATTGG - Intergenic
981390109 4:144179590-144179612 TTCTGAGATAAGAAGGAAACAGG + Intergenic
981602024 4:146500722-146500744 CTCTGTGATGAAAGGGAAAAGGG - Intronic
982160772 4:152567314-152567336 TGCTGTTATCAGAAGGAGATTGG - Intergenic
983103114 4:163650816-163650838 CTCTGAGATTAGCAGGAAATAGG - Intronic
983122618 4:163906231-163906253 CTCTGTGAGCAGAGAAAAATGGG - Intronic
983359726 4:166712767-166712789 CTCTGGGAACAGAAGATAATAGG - Intergenic
983403924 4:167301612-167301634 CTCTGTGATGATAAGGAACTTGG + Intergenic
985748023 5:1658347-1658369 CTCTGAAATGAAAAGGAAATGGG - Intergenic
988393321 5:30664194-30664216 CTTTGTGATAAAAAGGAAAAAGG + Intergenic
992170786 5:74099837-74099859 CTCTGTGCCCAGGAGGAAATGGG + Intergenic
992925747 5:81584597-81584619 CTATGTGATATGAAGGAAACAGG + Intronic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994114840 5:96050447-96050469 CTCTGTGATGAGAAGAAAGCTGG + Intergenic
994593613 5:101804658-101804680 CTCTGTCATCAGTATGGAATTGG + Intergenic
996347871 5:122507154-122507176 TTCTGTGTCCTGAAGGAAATAGG + Intergenic
996714120 5:126572868-126572890 CTGTGTATTCAGAAGGATATAGG - Intronic
997081422 5:130743996-130744018 CAGTGTCATCAGAAGGATATAGG - Intergenic
997667186 5:135640552-135640574 GTCTGTGTTCAGAGGGATATTGG - Intergenic
997697172 5:135870800-135870822 CTCTTTTAACATAAGGAAATGGG + Intronic
999851905 5:155549758-155549780 ATCTGTGTTCATAAGGATATTGG + Intergenic
1000344077 5:160299950-160299972 CAATGGCATCAGAAGGAAATTGG - Intronic
1001029207 5:168249678-168249700 CTCTGTGATAAGTGAGAAATGGG + Intronic
1001515404 5:172351991-172352013 CTCTGGGGTGAGAAGGGAATGGG + Intronic
1001694991 5:173663460-173663482 CTCTGTAGTCAGAAGGATCTAGG - Intergenic
1001990235 5:176110598-176110620 CTCTGGGATGAGAAGGAACGAGG - Intronic
1002064444 5:176645078-176645100 CCCTGTGTTCAAAGGGAAATGGG - Intronic
1002226637 5:177727542-177727564 CTCTGGGATGAGAAGGAACGAGG + Intronic
1002257946 5:177972885-177972907 CTCTGTGCACTGAAGTAAATGGG + Intergenic
1002267206 5:178043671-178043693 CTCTGGGATGAGAAGGAACGAGG - Intronic
1002930047 6:1627395-1627417 CTCTGGGCTGAGAAGGAATTAGG + Intronic
1003307140 6:4939879-4939901 CTCTGCGGTCATAAGAAAATCGG + Intronic
1006415065 6:33898754-33898776 ACCTCTGATCAGAAGGAAAATGG - Intergenic
1006637676 6:35472211-35472233 CTTTGCAATCAGAAGGAAAAGGG + Intergenic
1007085238 6:39139744-39139766 GTCTTTGAACAGAGGGAAATAGG + Intergenic
1007126810 6:39432569-39432591 TTTTCTGATCAGAAGCAAATGGG + Intronic
1008375651 6:50788084-50788106 TTCTGCAACCAGAAGGAAATTGG - Intergenic
1008918082 6:56811356-56811378 CCCTGCTACCAGAAGGAAATGGG + Intronic
1009789737 6:68386195-68386217 CTCTGGGAGCAGAGGGAACTAGG - Intergenic
1011508593 6:88075115-88075137 TTATGTTAACAGAAGGAAATTGG - Intergenic
1011575748 6:88796673-88796695 CTCTATGAAGAGAAGGAAAGGGG + Intronic
1013156333 6:107493584-107493606 CTCTGTGAGCTGAAAGAAAAAGG + Intronic
1013431880 6:110063082-110063104 CTCTGAGAACAGAAGTAACTTGG + Intergenic
1014729755 6:125019073-125019095 CTCTGTGATCAGAGGCAAGCGGG - Intronic
1015200427 6:130573624-130573646 TACTGTGATGAGAAAGAAATAGG - Intergenic
1017417166 6:154233568-154233590 CTCTGGGTTCTGTAGGAAATTGG - Intronic
1018366832 6:163129650-163129672 CCCTGTGATCAGTAGGAAGATGG - Intronic
1019290782 7:249023-249045 CTCTGTGCACAGAAGGACATTGG - Intronic
1020258801 7:6518790-6518812 CACTGTGATCTAAAGGAATTTGG + Intronic
1020424919 7:8054179-8054201 CTCTATGATAAAAAAGAAATAGG - Intronic
1021231528 7:18091387-18091409 AGCTGTGATAAGAAGGAGATGGG + Intronic
1021649148 7:22816067-22816089 CACTGTTTTCATAAGGAAATGGG + Intronic
1022810084 7:33860081-33860103 CCCTGAGATAAGGAGGAAATGGG + Intergenic
1023256065 7:38313511-38313533 CACAGTGATCAGTAGGAAACAGG + Intergenic
1023463893 7:40432292-40432314 CTCACTGACCAGAAGGGAATAGG - Intronic
1025966943 7:66282247-66282269 CACAGTGATTAGAGGGAAATGGG - Intronic
1027734658 7:81917588-81917610 TTCTGTAAAAAGAAGGAAATTGG - Intergenic
1030400975 7:109049761-109049783 CTCTGTGATAAGGAGGAGCTTGG + Intergenic
1030469880 7:109950512-109950534 CCCTGTGCTCAGAAGAAAAGAGG + Intergenic
1030484256 7:110146563-110146585 CTCTGTGATCTTAAGAAAAAGGG + Intergenic
1030952059 7:115803021-115803043 ATCTGTGACCACAAGGAAAGAGG - Intergenic
1032670033 7:134074172-134074194 CTCTGGGGTCAGGAGGAAAGAGG - Intergenic
1033537986 7:142329226-142329248 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033551527 7:142452009-142452031 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033948773 7:146757912-146757934 CAATGTAATCAGAAGTAAATAGG - Intronic
1034747355 7:153534881-153534903 CTCTGTCATCAGGAGGCAGTAGG + Intergenic
1036408930 8:8480200-8480222 CTCCTTCATCAGAAGGACATTGG + Intergenic
1037124127 8:15324433-15324455 CTCTGTGATCTAGAGTAAATTGG - Intergenic
1038696857 8:29813843-29813865 CTGTGTGGTCAGAAGTAACTAGG + Intergenic
1038818556 8:30931452-30931474 CTCTGGGAGCAGAAGGGATTAGG - Intergenic
1039854246 8:41398694-41398716 TTCTGTGCTCAGAAGGAAAAGGG + Intergenic
1041739310 8:61140999-61141021 ATTTGTGATCAGACGGAACTGGG + Intronic
1042678375 8:71349042-71349064 CTCTGAGATCAAATGGAGATGGG - Intronic
1044408734 8:91861222-91861244 CTCTGTTTTCAGAAGAAACTAGG - Intergenic
1044844300 8:96365163-96365185 CTTCGTGCTCAGAAGGAACTTGG + Intergenic
1045132380 8:99168343-99168365 AACTGTACTCAGAAGGAAATTGG - Intronic
1045363436 8:101453894-101453916 CTCTGTGATCACTAGGAATAGGG + Intergenic
1047629260 8:126689001-126689023 ACCTGAGATCAGAAGGAAGTAGG - Intergenic
1048220357 8:132535238-132535260 CTCTGCAATCAGAAAGAACTAGG + Intergenic
1050666234 9:7939608-7939630 GCATGTGATCAGTAGGAAATGGG + Intergenic
1052105982 9:24516645-24516667 CTCAGAGATATGAAGGAAATAGG - Intergenic
1053593273 9:39534193-39534215 CCCTGAGATCAGAAGAAAGTGGG + Intergenic
1053851006 9:42288901-42288923 CCCTGAGATCAGAAGAAAGTGGG + Intergenic
1054573033 9:66831084-66831106 CCCTGAGATCAGAAGAAAGTGGG - Intergenic
1056443437 9:86642364-86642386 CACTGAGATCAGAAGACAATTGG - Intergenic
1056765300 9:89441421-89441443 GTCTGGGATCAGAAGGAAAGGGG + Intronic
1057676056 9:97137012-97137034 CTCTATGATCAGAAAGAAACGGG + Intergenic
1057921816 9:99104494-99104516 CGCTGGGAGCAGGAGGAAATAGG + Intronic
1058982116 9:110179741-110179763 CTCAGTGATCAGAGGGTATTGGG + Intergenic
1059124972 9:111675803-111675825 CTCTTTGATGAGAAGCAAGTGGG + Intergenic
1059569103 9:115415316-115415338 CACTGTTAAGAGAAGGAAATTGG - Intergenic
1061550163 9:131329705-131329727 CTCTGTGATCAGGGGGACCTTGG + Intergenic
1061752048 9:132785718-132785740 CACTGTGGACAGAATGAAATTGG - Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1186591888 X:10939318-10939340 CTCTATTATCAGACGGAAACTGG - Intergenic
1187213792 X:17254919-17254941 CTCTGGGAACAGAAGGGACTAGG + Intergenic
1189833489 X:44998290-44998312 CTCTGTGAATAGAAGGAACATGG + Intronic
1190244602 X:48683045-48683067 CTCTGTAATTAAAAGGAAAAGGG + Intronic
1191975066 X:66862413-66862435 CTCTGTGCTTAGAAGCAAACAGG + Intergenic
1193810484 X:86044896-86044918 TTTTCTAATCAGAAGGAAATGGG + Intronic
1194661318 X:96630779-96630801 TTCTGTGATCAGAATATAATTGG - Intergenic
1196457200 X:115898993-115899015 CTCAGTGAAGAGAAGGAGATTGG + Intergenic