ID: 1072706957

View in Genome Browser
Species Human (GRCh38)
Location 10:97687551-97687573
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072706951_1072706957 -9 Left 1072706951 10:97687537-97687559 CCTGCCCCAGGGTGCGGCGAAAG No data
Right 1072706957 10:97687551-97687573 CGGCGAAAGCTGGCCCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072706957 Original CRISPR CGGCGAAAGCTGGCCCTGCC GGG Intergenic
No off target data available for this crispr