ID: 1072708040

View in Genome Browser
Species Human (GRCh38)
Location 10:97696308-97696330
Sequence CTGCAGAAGCATAATGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072708040_1072708047 22 Left 1072708040 10:97696308-97696330 CCTTGCCCATTATGCTTCTGCAG No data
Right 1072708047 10:97696353-97696375 GAATGCCTTATTTACCATCGTGG No data
1072708040_1072708044 -8 Left 1072708040 10:97696308-97696330 CCTTGCCCATTATGCTTCTGCAG No data
Right 1072708044 10:97696323-97696345 TTCTGCAGGAACAGCACCCATGG No data
1072708040_1072708048 23 Left 1072708040 10:97696308-97696330 CCTTGCCCATTATGCTTCTGCAG No data
Right 1072708048 10:97696354-97696376 AATGCCTTATTTACCATCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072708040 Original CRISPR CTGCAGAAGCATAATGGGCA AGG (reversed) Intergenic
No off target data available for this crispr