ID: 1072708511

View in Genome Browser
Species Human (GRCh38)
Location 10:97699736-97699758
Sequence CTTTGGAAGCCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072708511_1072708518 19 Left 1072708511 10:97699736-97699758 CCTTCCACCTTGGGCTTCCAAAG No data
Right 1072708518 10:97699778-97699800 AGCCACTATGCCCAGCCAGCAGG No data
1072708511_1072708515 -8 Left 1072708511 10:97699736-97699758 CCTTCCACCTTGGGCTTCCAAAG No data
Right 1072708515 10:97699751-97699773 TTCCAAAGTACTGGAATTACAGG 0: 17
1: 1322
2: 32193
3: 336613
4: 258030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072708511 Original CRISPR CTTTGGAAGCCCAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr