ID: 1072708737

View in Genome Browser
Species Human (GRCh38)
Location 10:97701665-97701687
Sequence GCCTCTCACTAGGCTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072708734_1072708737 -6 Left 1072708734 10:97701648-97701670 CCTTGGTTCTTGTGTGCGCCTCT No data
Right 1072708737 10:97701665-97701687 GCCTCTCACTAGGCTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072708737 Original CRISPR GCCTCTCACTAGGCTCCTGT GGG Intergenic
No off target data available for this crispr