ID: 1072710780

View in Genome Browser
Species Human (GRCh38)
Location 10:97714422-97714444
Sequence GGGGATTCCCCCGCCCCGAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072710780_1072710790 23 Left 1072710780 10:97714422-97714444 CCGATCGGGGCGGGGGAATCCCC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1072710790 10:97714468-97714490 TCCCCCGCCGCCGCCCCGCGCGG 0: 1
1: 0
2: 2
3: 59
4: 609
1072710780_1072710792 24 Left 1072710780 10:97714422-97714444 CCGATCGGGGCGGGGGAATCCCC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1072710792 10:97714469-97714491 CCCCCGCCGCCGCCCCGCGCGGG 0: 1
1: 2
2: 26
3: 168
4: 970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072710780 Original CRISPR GGGGATTCCCCCGCCCCGAT CGG (reversed) Exonic
918955144 1:191198621-191198643 GGGGACTCCCCTGCCCCATTTGG - Intergenic
919986356 1:202678595-202678617 GGGGCTTCCCCCCTCCCTATAGG + Intronic
920332582 1:205221055-205221077 GGCGATTCTCCCGCCTCGGTGGG + Intergenic
1063488267 10:6440068-6440090 GGGGCTTCCCCCTTCCCGCTTGG + Intronic
1065519024 10:26553553-26553575 AGTGATTCTCCCACCCCGATCGG - Intronic
1072710780 10:97714422-97714444 GGGGATTCCCCCGCCCCGATCGG - Exonic
1092253807 12:6915638-6915660 AGGGATTCCCCCTCCCCCCTGGG - Exonic
1105876649 13:24560794-24560816 GGGCCTTCCCCCGCCTCCATGGG - Intergenic
1117093719 14:52275535-52275557 GGGGCTTCCCCAGCCACCATCGG + Exonic
1117876028 14:60250035-60250057 GGGGACGCCCCCTCCCCGCTCGG - Intronic
1120198608 14:81514174-81514196 AGTTAGTCCCCCGCCCCGATGGG - Intronic
1128632724 15:69282179-69282201 GGGGATTCCCTCCCTCCAATCGG - Intergenic
1135986716 16:27189544-27189566 GGGGAAGCCCCCGCCACGACAGG + Intergenic
1141694209 16:85612216-85612238 GGGGACGCGCCCGCCGCGATGGG + Intronic
1142957239 17:3530291-3530313 GGGGATACACCCGCCCAGAATGG + Intronic
1147237379 17:39067988-39068010 GGGCATGCCCCCGCCCCCATGGG + Intronic
1151328839 17:73394922-73394944 AGGGATACCCCCGCCCCCCTTGG + Intronic
1152430864 17:80247725-80247747 GGGGATTCCACCGCACGCATAGG - Intronic
1152493544 17:80654205-80654227 GGAGATTCCCCCACCCCGTGGGG + Intronic
1153950178 18:10051831-10051853 GAGGCTTCCCCAGCCCCCATAGG - Intergenic
1158515000 18:58123515-58123537 GAGGAGACCCCCGCCCCGGTTGG + Intronic
932699782 2:73984853-73984875 GGGGACTCCCCCGCCCGGGAGGG - Intergenic
940273522 2:151915994-151916016 GGGGGTTCCCCTGCCCCGTGTGG + Intronic
944474161 2:200086993-200087015 GGGGATTCACCGGGCCAGATGGG + Intergenic
1171788725 20:29498124-29498146 GGTGATTCCTCCGCAGCGATGGG + Intergenic
1173834776 20:46118198-46118220 GGGGGCTCCGCCCCCCCGATAGG + Intergenic
1176117479 20:63439385-63439407 GGGGGTTCCCCAGCCCCGACAGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
954139435 3:48597242-48597264 GGGGGCTCCACCGCCCTGATGGG - Intergenic
956560258 3:70567066-70567088 GGGGATTCCCATCCCCCCATGGG + Intergenic
964007854 3:151852502-151852524 GGGGACTCCCCTGCCCCGTGTGG + Intergenic
979468911 4:121072265-121072287 CGGGATTCCCCAGCCCCGCGCGG - Exonic
986758309 5:10857660-10857682 GGGGACTCCCCCGCACCCAGCGG - Intergenic
988964613 5:36403693-36403715 GGGGATTGCCCCACCCTGTTGGG - Intergenic
994171285 5:96662239-96662261 GGGGTTCCCCTAGCCCCGATGGG - Exonic
997640926 5:135448480-135448502 AGGAATTCCCCCACCCCCATTGG + Exonic
1022230724 7:28409985-28410007 GGGGGTTCCGCCGCCACGCTGGG - Intronic
1039686022 8:39802224-39802246 GGGGATTCCCCTTCCCCGTGCGG + Intronic
1049762391 8:144337219-144337241 GGGAATTCCCCCGCGCGGCTCGG + Intergenic
1053463672 9:38289645-38289667 GGGGATTTCCCAGGCCCAATTGG - Intergenic
1058374220 9:104304814-104304836 GGGGATTCCCCTTCCCCGTGTGG - Intergenic
1061972885 9:134054304-134054326 GGGGCTTCCCTGGCCCCGACTGG + Intronic