ID: 1072713948

View in Genome Browser
Species Human (GRCh38)
Location 10:97737134-97737156
Sequence CGTCCCGGAAGCGGCGGTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072713941_1072713948 22 Left 1072713941 10:97737089-97737111 CCGGAGCGGGATGACGTCATGAG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1072713948 10:97737134-97737156 CGTCCCGGAAGCGGCGGTGGCGG 0: 1
1: 0
2: 2
3: 12
4: 180
1072713943_1072713948 -8 Left 1072713943 10:97737119-97737141 CCGCAGAGCGATTCGCGTCCCGG 0: 1
1: 0
2: 0
3: 0
4: 12
Right 1072713948 10:97737134-97737156 CGTCCCGGAAGCGGCGGTGGCGG 0: 1
1: 0
2: 2
3: 12
4: 180
1072713940_1072713948 23 Left 1072713940 10:97737088-97737110 CCCGGAGCGGGATGACGTCATGA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1072713948 10:97737134-97737156 CGTCCCGGAAGCGGCGGTGGCGG 0: 1
1: 0
2: 2
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072713948 Original CRISPR CGTCCCGGAAGCGGCGGTGG CGG Exonic