ID: 1072715448

View in Genome Browser
Species Human (GRCh38)
Location 10:97749470-97749492
Sequence CAGAAGAGCCCCATAGAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072715448_1072715451 16 Left 1072715448 10:97749470-97749492 CCAGGTTCTATGGGGCTCTTCTG 0: 1
1: 0
2: 1
3: 11
4: 184
Right 1072715451 10:97749509-97749531 TGTATTTGCTGCCACTCTGCTGG 0: 1
1: 0
2: 4
3: 31
4: 385
1072715448_1072715452 17 Left 1072715448 10:97749470-97749492 CCAGGTTCTATGGGGCTCTTCTG 0: 1
1: 0
2: 1
3: 11
4: 184
Right 1072715452 10:97749510-97749532 GTATTTGCTGCCACTCTGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072715448 Original CRISPR CAGAAGAGCCCCATAGAACC TGG (reversed) Exonic
900078393 1:836295-836317 CAGCAGAGCCACATGGAGCCAGG - Intergenic
900858016 1:5201456-5201478 CAGAGGACCCCCATAGGCCCTGG - Intergenic
903447547 1:23431816-23431838 CTGATGAGCCCCTTGGAACCTGG - Exonic
904327781 1:29738790-29738812 AAGCAGAGGCCCAGAGAACCAGG - Intergenic
904691023 1:32293225-32293247 CAGGAGAATCCCTTAGAACCCGG + Intronic
905235462 1:36543157-36543179 CAGAAGAGTCCCAGACACCCAGG - Intergenic
905670950 1:39789401-39789423 CAGAAGGGCCCCAGAGCTCCTGG - Intergenic
908328435 1:63046313-63046335 CAGAACTGCCCTAGAGAACCTGG - Intergenic
911636831 1:100245477-100245499 CAGATGGTCCCCATAGAACTAGG - Intronic
911660974 1:100500655-100500677 CAGGAGAATCCCTTAGAACCTGG + Intronic
912319944 1:108703599-108703621 CAGCAGAGTCGCTTAGAACCTGG + Intergenic
914679616 1:149929870-149929892 GAGAAGAGCCACACAGAACTGGG + Exonic
915330755 1:155110926-155110948 CAGAAGAGCCTGCAAGAACCAGG - Intergenic
915583063 1:156827353-156827375 CAAAAGAATCCCTTAGAACCTGG - Intronic
916547076 1:165815951-165815973 CTGAAGAGCCCCATATCTCCCGG - Intronic
920743917 1:208607488-208607510 AAGAAGAGCCACCTAAAACCTGG + Intergenic
923183443 1:231546787-231546809 CAGCAGAGCCCCAGAGAGCATGG - Intronic
924369179 1:243329322-243329344 CAGAAGAGACCAAAAGAAACTGG + Intronic
1064049163 10:12044889-12044911 CAGAAGAATCACTTAGAACCCGG + Intergenic
1064399498 10:15009673-15009695 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1067909014 10:50325422-50325444 CAGAAGATCCTCATAGAATGAGG + Intronic
1070846775 10:79529275-79529297 CAGGAGAACCTCTTAGAACCTGG + Intergenic
1070927022 10:80230992-80231014 CAGGAGAACCTCTTAGAACCCGG - Intergenic
1071528435 10:86371904-86371926 CTGAAGAGCCTCTTAGATCCAGG - Intergenic
1072253059 10:93596757-93596779 CAGAACAGACCAATGGAACCAGG - Intronic
1072715448 10:97749470-97749492 CAGAAGAGCCCCATAGAACCTGG - Exonic
1073144586 10:101272261-101272283 CAGAAGGGACCCATATGACCGGG + Intergenic
1073160845 10:101393227-101393249 ATGAAGAGACCCATAGAACAAGG - Intronic
1073443891 10:103569646-103569668 CAGAAGAGCCCCAGACAGTCTGG - Intronic
1074005911 10:109423026-109423048 CAGAAGAGCCTCATTAATCCTGG + Intergenic
1074219314 10:111420762-111420784 CAGAAGAGTCCCATGGGAACAGG - Intergenic
1075285554 10:121182642-121182664 CAGATTAGCCCAGTAGAACCAGG - Intergenic
1076126900 10:127981909-127981931 CAGAAGAGCCTTTTACAACCTGG - Intronic
1077604714 11:3601443-3601465 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1078832288 11:14989467-14989489 CAGGAGAATCCCTTAGAACCTGG + Intronic
1081745093 11:45467513-45467535 CAGGACAGCCCCACAGAAGCCGG + Intergenic
1081791018 11:45784999-45785021 CAGGAGAATCCCTTAGAACCTGG - Intergenic
1081978849 11:47253819-47253841 CAGAAGAGGCCCATAGGACTGGG + Intronic
1082666391 11:55980927-55980949 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1084227177 11:67724256-67724278 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1084260613 11:67976028-67976050 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1084812166 11:71619207-71619229 CAGGAGAATCCCTTAGAACCTGG - Intergenic
1084845133 11:71892612-71892634 CAGGAGAATCCCTTAGAACCTGG - Intronic
1085040342 11:73323150-73323172 CTGAAGAGCCCCAGAGCTCCAGG + Intronic
1085859180 11:80212115-80212137 CAGAGGAGCCCCAGAGAGGCTGG - Intergenic
1086103835 11:83128841-83128863 CAGACCAGCCCCACAGACCCAGG + Intergenic
1086820803 11:91433713-91433735 CAGGAGATCCCCATACCACCAGG - Intergenic
1088110128 11:106251324-106251346 CAGAAGAGAACCATGGAACCTGG - Intergenic
1088433459 11:109783885-109783907 AAGAAAAGCCCCATAGAAAGGGG + Intergenic
1090036367 11:123253044-123253066 CAGGAGAACCCCTTAGAACCTGG - Intergenic
1090097159 11:123753757-123753779 CAGAACAGCCCCGTAGAGCAGGG + Exonic
1091819303 12:3463022-3463044 CAGAAGAAGGCCCTAGAACCTGG + Intronic
1093896834 12:24583762-24583784 CACAAGAGCCCCAGGGAACACGG + Intergenic
1094471067 12:30801885-30801907 CAGAAGAGTCCCACAGAATAGGG + Intergenic
1095295515 12:40522968-40522990 CAGAAGAGCTCTGTGGAACCAGG + Intronic
1095295943 12:40527616-40527638 GAAAAGAGCCCCATGGACCCAGG + Intronic
1095297353 12:40542136-40542158 CAAAAGAGCACCATGGACCCAGG + Intronic
1100985309 12:100197948-100197970 CAGAGGAGCCCGAGAGAACATGG + Intergenic
1103506693 12:121445808-121445830 CAGAAAAGCCCCAAAGGAGCAGG + Intronic
1104583718 12:130030410-130030432 TAGAACAACCCCACAGAACCAGG + Intergenic
1104761813 12:131301206-131301228 GGGAAGAGCCTCAAAGAACCCGG + Intergenic
1104817960 12:131659578-131659600 GGGAAGAGCCTCAAAGAACCCGG - Intergenic
1107546867 13:41441635-41441657 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1113546164 13:111153241-111153263 CAGAGGGGCCCCAGAGAACTCGG - Intronic
1113985598 13:114313568-114313590 CAGGAGAATCCCATAGAACCGGG - Intergenic
1114612675 14:24052645-24052667 CTGAAGAGCCCCTTAGGAGCTGG + Intronic
1116562592 14:46400096-46400118 AAGGAGAGGCCCATAGAACAAGG - Intergenic
1119633986 14:76258897-76258919 CAGGAGAGCCACATACACCCAGG - Intergenic
1119635338 14:76268805-76268827 CAGAAGAGACCCAGAGATCCAGG + Intergenic
1119736872 14:76988230-76988252 CAGAGGAGCCACAGAGATCCAGG + Intergenic
1120584086 14:86289384-86289406 CAGAAAAGACCCAGAGAATCTGG - Intergenic
1125518694 15:40336689-40336711 GAGAAGAGGCCCATAGCAGCCGG + Intronic
1129120574 15:73394017-73394039 CAGCACATCCCCATAGAACTTGG - Intergenic
1130460896 15:84157730-84157752 GAGAGGAGCCCCAGAGGACCTGG - Intergenic
1131741838 15:95401169-95401191 AAGTAGACCACCATAGAACCTGG - Intergenic
1132508334 16:323989-324011 CAGGAGAGCCCCATAGTCCATGG + Intronic
1133424314 16:5674474-5674496 GAGAAGAGTCCCATAGATTCTGG - Intergenic
1135494312 16:22938212-22938234 CAGAAGAGCCCCAGAGGCCTGGG + Intergenic
1135960092 16:26988001-26988023 CAGAACAGCCACATGGCACCCGG - Intergenic
1136546200 16:30956512-30956534 CAGAAAAGACCCTTAGAGCCTGG - Intergenic
1139369652 16:66458911-66458933 CAGCAGAGGCCCATGGACCCAGG + Intronic
1141041517 16:80676502-80676524 CAGAAGAGGCCCAGGGAAACTGG - Intronic
1145225301 17:21123475-21123497 CACAGTAGCCCCGTAGAACCAGG - Intronic
1147133140 17:38420422-38420444 CAGAACAGCCCCAAAGAACTTGG - Intergenic
1149529150 17:57380917-57380939 CTGAAGACCCCCTGAGAACCTGG - Intronic
1152041337 17:77905899-77905921 CAGCTGAACCCCATAAAACCAGG + Intergenic
1154948904 18:21188831-21188853 CAGGAGAATCCCTTAGAACCCGG - Intergenic
1161242464 19:3229918-3229940 CAGGTGAGCCCCATAGAAGAAGG - Intronic
1162222993 19:9194700-9194722 CAGTAGAGCCACATAGCAACTGG - Intergenic
1164449735 19:28350513-28350535 CAGGCCAGCCCCATAGACCCAGG + Intergenic
1164618265 19:29679354-29679376 CAGAAGAATCGCTTAGAACCCGG - Intergenic
925036509 2:691099-691121 CAGAAGAGCCCCGTTGAGCTGGG + Intergenic
925212212 2:2059461-2059483 GAGCAGAGCCCCCTGGAACCAGG + Intronic
926854322 2:17236211-17236233 CTGAAGAATCCCATGGAACCTGG + Intergenic
931754634 2:65361893-65361915 CAGCAGAGCCCCACAGGGCCAGG + Intronic
932350599 2:71028061-71028083 CAGGAGAATCCCTTAGAACCTGG - Intergenic
932354098 2:71054321-71054343 CAGGAGAATCCCTTAGAACCTGG - Intergenic
934590508 2:95545729-95545751 CAGGAGAATCCCTTAGAACCTGG - Intergenic
938619867 2:133039145-133039167 CAGAGGAGCCCCACAGAAATAGG + Intronic
938806776 2:134813485-134813507 CAAGAGACCCACATAGAACCTGG + Intergenic
940870123 2:158852771-158852793 CAGGAGAATCCCTTAGAACCTGG - Intronic
940872833 2:158873829-158873851 CAGGAGAATCCCTTAGAACCTGG - Intergenic
943743932 2:191441378-191441400 TGGAAAAGCCCCACAGAACCAGG - Intergenic
945096190 2:206221844-206221866 CAGAAGAAACCCAATGAACCGGG - Intergenic
946688840 2:222295880-222295902 CAGACAAGCCCCAGACAACCGGG + Intronic
948824313 2:240566945-240566967 CTGGAGAGCCCCGTAGAACTGGG + Intronic
1168910082 20:1440537-1440559 CTGCAGAGCCCCATAGGCCCTGG - Intergenic
1170163209 20:13336887-13336909 CAGAAGAGACTCATTGAAACTGG - Intergenic
1181022878 22:20112769-20112791 CTGCAGAGCCCCATCTAACCGGG - Exonic
1184100945 22:42341558-42341580 CAGAAGACCCCCAAGGAAGCAGG + Intronic
1184158485 22:42684359-42684381 CAGAAGAGGACCATAGGGCCAGG + Intergenic
1184182884 22:42842928-42842950 CAAGAGAGCCCCATACAGCCTGG - Intronic
1184941282 22:47767269-47767291 CAGAAGTGCTCCACAGAACAGGG + Intergenic
951111419 3:18808857-18808879 CAGAAAAGCCACAGAGAATCAGG - Intergenic
951908446 3:27725725-27725747 CAGTTGAGCCACATAAAACCAGG - Intergenic
957035146 3:75287523-75287545 CAGAATAGCTCCATGGACCCAGG - Intergenic
959981810 3:112525993-112526015 CAGGAGAATCCCTTAGAACCTGG + Intergenic
961008984 3:123423674-123423696 CAGAAGGGCCCCAGAGGACAGGG + Intronic
961272876 3:125702510-125702532 CAGGAGAATCCCTTAGAACCTGG - Intergenic
961275622 3:125723680-125723702 CAGGAGAATCCCTTAGAACCTGG - Intergenic
961278540 3:125746301-125746323 CAGGAGAATCCCTTAGAACCTGG - Intergenic
961875860 3:130023355-130023377 CAGGAGAATCCCTTAGAACCTGG + Intergenic
962845033 3:139266677-139266699 CAGAGGGGCCTCATAGAGCCTGG + Intronic
964001216 3:151774605-151774627 CAGAAGAGACTCATGGAAACTGG - Intergenic
969019217 4:4128401-4128423 CAGGAGAATCCCTTAGAACCTGG + Intergenic
969023854 4:4158277-4158299 CAGGAGAATCCCTTAGAACCTGG + Intergenic
969786128 4:9458419-9458441 CAGGAGAATCCCTTAGAACCTGG - Intergenic
969789571 4:9482903-9482925 CAGGAGAATCCCTTAGAACCTGG - Intergenic
969794048 4:9512073-9512095 CAGGAGAATCCCTTAGAACCTGG - Intergenic
970455144 4:16216161-16216183 CAGAAGAGCACCACTGAATCAGG - Intronic
973959447 4:56095274-56095296 CAGAAGAGCCCCAACCACCCGGG - Intergenic
975857787 4:78642802-78642824 AAGAAGAGTCCCATAGAATAAGG + Intergenic
976578824 4:86709787-86709809 CACAAGACCCCCATAGAAGGAGG + Intronic
977479333 4:97555121-97555143 CAGAAAAGCACCATAGAACAAGG - Intronic
980309932 4:131113560-131113582 CAGAAAAGCCACATAGAAAGTGG + Intergenic
984540354 4:181030621-181030643 CAGGAGAGACTCAGAGAACCTGG + Intergenic
984540382 4:181030780-181030802 CAGGAGAGACTCAGAGAACCTGG + Intergenic
984540411 4:181030939-181030961 CAGGAGAGACTCAGAGAACCTGG + Intergenic
985323998 4:188746767-188746789 CAGAAGAGTCCCATGAACCCAGG + Intergenic
985772211 5:1819468-1819490 CAGAAAAGCCACATACAAACTGG + Intergenic
987427980 5:17795211-17795233 CATAAAAGCCCCATAGAGCAGGG + Intergenic
988331632 5:29849372-29849394 CAGAAAAGCCACATAAAATCTGG + Intergenic
989617428 5:43350867-43350889 CAGACGAGCCACCTAAAACCAGG - Intergenic
995981362 5:118108300-118108322 GAGAAAAGTCCCATAGACCCAGG - Intergenic
996074939 5:119181333-119181355 CAGATGAGCACCATATAACCTGG - Intronic
998098450 5:139412001-139412023 AAGAAGGGCCCCCTAAAACCAGG + Exonic
1005273169 6:24187610-24187632 CAGAAGACCTCCATAGTGCCAGG - Intronic
1007654633 6:43444880-43444902 GAGAAGAGCCCCATAGAAGCTGG - Exonic
1009460670 6:63909067-63909089 CTGAAAAGGCCCATAGAGCCAGG + Intronic
1010231610 6:73540107-73540129 CAGAACAGCCCCCTACAACAAGG + Intergenic
1014170552 6:118274488-118274510 CAGAAGAATCCCTCAGAACCCGG - Intronic
1016883497 6:148934972-148934994 CAGAAGAGCTCTATAGACTCTGG + Intronic
1019223729 6:170494398-170494420 GAGAAGAGCCATAAAGAACCTGG - Intergenic
1019954472 7:4402368-4402390 GAGAAGAGTCCCATAGGACGGGG - Intergenic
1020306379 7:6838762-6838784 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1020310956 7:6868449-6868471 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1022622514 7:31999469-31999491 CAGTAGAGCCCAACAGAGCCTGG + Intronic
1023106997 7:36772291-36772313 AAGAAGAGCCCCATAGTGGCAGG - Intergenic
1023151915 7:37209495-37209517 CACAGGAGCACCCTAGAACCAGG + Intronic
1023275350 7:38513376-38513398 CAGGAGACACCCATTGAACCTGG + Intronic
1024539597 7:50465462-50465484 CAGGAGAACCACATTGAACCTGG - Intronic
1028033585 7:85950193-85950215 CAGAAGAATCGCTTAGAACCCGG - Intergenic
1028671998 7:93411644-93411666 CAGAAGAGCCTCTGACAACCTGG - Intergenic
1031987479 7:128172445-128172467 CAGAACAGCCGCATTGCACCTGG - Intergenic
1032381544 7:131488607-131488629 CAGAAGAGCTCTGCAGAACCAGG + Exonic
1033018270 7:137694538-137694560 CAGAAAAGCACCAGAGAATCAGG + Intronic
1033114410 7:138612606-138612628 CAGGAGAATCCCTTAGAACCTGG - Intronic
1033470809 7:141647334-141647356 CAGCAGAGCCTCATAGACCATGG - Intronic
1034530802 7:151695298-151695320 CAGAAGAGTCCCAAAGATCAAGG - Intronic
1036819648 8:11930368-11930390 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG + Exonic
1045434866 8:102152429-102152451 CAGAAAAGTCCCATAGTTCCAGG - Intergenic
1046590645 8:116202002-116202024 CAGCTGTGCCTCATAGAACCTGG + Intergenic
1047338309 8:123956701-123956723 CAGAAGAGCCTCATTGCACTTGG - Intronic
1047343970 8:124009586-124009608 CAGAAGAGCCACACAGGAGCTGG + Intronic
1048265440 8:132981463-132981485 CAGAAGAGACTCACAGAACCAGG - Intronic
1049148936 8:141021964-141021986 CAGACGAGCCCCAGAGCTCCAGG - Intergenic
1049481365 8:142825218-142825240 CCGAAAAGCCCCATGCAACCGGG - Intergenic
1050052562 9:1618432-1618454 CAGAAGAGCCCAATAGCAGAAGG - Intergenic
1050859565 9:10409786-10409808 CAGAAGCGGCCCATAGAGACAGG + Intronic
1051113780 9:13671026-13671048 CAGGTGAGCCCCATAGCGCCTGG + Intergenic
1052792338 9:32887203-32887225 CTGAAGATACCCATAGATCCTGG - Intergenic
1054574612 9:66844192-66844214 TAGAAGTGCCCCATAGTGCCTGG - Intergenic
1055875995 9:80942018-80942040 CAGAAGAATCCCCTTGAACCAGG + Intergenic
1055941837 9:81658001-81658023 CAGGAGAGTTCCTTAGAACCCGG - Intronic
1056866472 9:90231291-90231313 CAGGAGAATCCCTTAGAACCTGG - Intergenic
1056916690 9:90753029-90753051 CAGGAGAATCCCTTAGAACCTGG + Intergenic
1057851338 9:98568930-98568952 CAGAAGAGACCCCAAGGACCTGG - Intronic
1059433138 9:114261575-114261597 CAGCAGAGCACCAGAGAACCCGG - Intronic
1060736825 9:126071389-126071411 GAGAAGAGCCCCAAAAACCCAGG - Intergenic
1062235188 9:135504538-135504560 CAAAACAGCCCCCTGGAACCAGG - Exonic
1062422202 9:136488205-136488227 CAGGAGAGTCCCCAAGAACCCGG + Intergenic
1186417144 X:9393630-9393652 GAGAAAAGCCCCATTCAACCTGG + Intergenic
1189346246 X:40243575-40243597 CAGAAGAGCCCCAGAGAAAAGGG + Intergenic
1193022468 X:76805017-76805039 CAGATGTTCCCCACAGAACCTGG + Intergenic
1195255094 X:103082376-103082398 CAGAAGAACCACGTAGACCCAGG + Intronic