ID: 1072715977

View in Genome Browser
Species Human (GRCh38)
Location 10:97752942-97752964
Sequence GCGGCAGCCCCCACGAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072715977_1072715985 22 Left 1072715977 10:97752942-97752964 CCACACCTCGTGGGGGCTGCCGC 0: 1
1: 0
2: 3
3: 30
4: 225
Right 1072715985 10:97752987-97753009 TCCTGCAGCCTTGCAAGAGGTGG 0: 1
1: 0
2: 3
3: 14
4: 217
1072715977_1072715984 19 Left 1072715977 10:97752942-97752964 CCACACCTCGTGGGGGCTGCCGC 0: 1
1: 0
2: 3
3: 30
4: 225
Right 1072715984 10:97752984-97753006 GGGTCCTGCAGCCTTGCAAGAGG 0: 1
1: 0
2: 0
3: 23
4: 163
1072715977_1072715981 -2 Left 1072715977 10:97752942-97752964 CCACACCTCGTGGGGGCTGCCGC 0: 1
1: 0
2: 3
3: 30
4: 225
Right 1072715981 10:97752963-97752985 GCGCAGGATGCCTCTGCACACGG 0: 1
1: 0
2: 0
3: 16
4: 128
1072715977_1072715987 23 Left 1072715977 10:97752942-97752964 CCACACCTCGTGGGGGCTGCCGC 0: 1
1: 0
2: 3
3: 30
4: 225
Right 1072715987 10:97752988-97753010 CCTGCAGCCTTGCAAGAGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 213
1072715977_1072715982 -1 Left 1072715977 10:97752942-97752964 CCACACCTCGTGGGGGCTGCCGC 0: 1
1: 0
2: 3
3: 30
4: 225
Right 1072715982 10:97752964-97752986 CGCAGGATGCCTCTGCACACGGG 0: 1
1: 0
2: 1
3: 12
4: 150
1072715977_1072715988 27 Left 1072715977 10:97752942-97752964 CCACACCTCGTGGGGGCTGCCGC 0: 1
1: 0
2: 3
3: 30
4: 225
Right 1072715988 10:97752992-97753014 CAGCCTTGCAAGAGGTGGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072715977 Original CRISPR GCGGCAGCCCCCACGAGGTG TGG (reversed) Intronic
900112461 1:1014255-1014277 GCAGCAGCACCTACGAGGTACGG + Exonic
900337478 1:2171794-2171816 GTGGCAGCCTCCACAAGGGGAGG - Intronic
900389434 1:2427605-2427627 GCGGCAGTGCCCAGGAAGTGGGG - Intronic
900476940 1:2880383-2880405 GTGGCAGCACCCACCAAGTGGGG + Intergenic
900495268 1:2973295-2973317 GGGGCAGCTCCCACGAGGGCTGG - Intergenic
900513916 1:3072481-3072503 GCTGCAGCCCCCACTAGATGGGG + Intronic
902799451 1:18820180-18820202 GCGCCAGTCCTCACGAGCTGCGG - Intergenic
906676657 1:47698211-47698233 GGGGCAGGCCCCACCAGGGGAGG - Intergenic
910936249 1:92485963-92485985 GCGGCCGCCCCCACCAGGGCAGG + Intronic
913451100 1:118993193-118993215 GCGGCCGCGCCCAAGAGGTGAGG + Intergenic
915322857 1:155065393-155065415 CAGGCAGCTCCCAAGAGGTGGGG + Intronic
916969975 1:170003434-170003456 GAGGCACCCCCCAGTAGGTGTGG - Intronic
920373797 1:205495543-205495565 GCGGGTGCCTCCACGAGGTTGGG + Intergenic
1065092882 10:22252600-22252622 GCGGCAGCCCCCAGGGGACGCGG + Intergenic
1069663365 10:70138583-70138605 AGGGCAGCCCCCAGGAGCTGAGG - Exonic
1069902680 10:71715073-71715095 GCGGCAGCCTCCCCGAGGGTGGG - Exonic
1072715977 10:97752942-97752964 GCGGCAGCCCCCACGAGGTGTGG - Intronic
1073823362 10:107291267-107291289 GCAGCATTCCCCACAAGGTGAGG - Intergenic
1073854785 10:107661807-107661829 GAGGCAGGCCCCTAGAGGTGAGG + Intergenic
1077480639 11:2812816-2812838 GCGGAAGCCCCCAGGAGGCTGGG - Intronic
1079850636 11:25529761-25529783 GCTGGAGCCCCCAGGAGGTCAGG + Intergenic
1083571821 11:63765226-63765248 CCGGCAGCCCCCACCAGCTGGGG + Exonic
1084264071 11:67996025-67996047 GAGGCACCCCCCACGATGCGGGG - Intronic
1091124561 11:133082961-133082983 GCGGCCGCGCGGACGAGGTGCGG - Intronic
1091274827 11:134342943-134342965 GGGGCAGCACCTACGTGGTGAGG - Exonic
1092537586 12:9403513-9403535 GAGGCACCCCCCGCGAGGTGGGG + Intergenic
1092538066 12:9404940-9404962 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092538409 12:9405815-9405837 GAGGCATCCCCCACGAGTCGGGG + Intergenic
1092538441 12:9405894-9405916 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092538550 12:9406213-9406235 GAGGCATCCCCCACGAGGCGGGG + Intergenic
1092538645 12:9406580-9406602 GAGGCACCCCACACGAGGCGGGG + Intergenic
1092539098 12:9408626-9408648 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092556580 12:9567705-9567727 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1092557133 12:9570028-9570050 GAGGCAAACCCCGCGAGGTGGGG - Intergenic
1092557142 12:9570054-9570076 GAGGCAAACCCCGCGAGGTGGGG - Intergenic
1092557196 12:9570211-9570233 ATGGCACCCCCCGCGAGGTGGGG - Intergenic
1092894521 12:12999966-12999988 GCTGCAGCCCCGACGAGGGTGGG + Intronic
1094514072 12:31117851-31117873 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514232 12:31118324-31118346 GGGGCAACCCCCACGAGGCGGGG + Intergenic
1094514258 12:31118403-31118425 GTGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514601 12:31119565-31119587 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514657 12:31119725-31119747 GAGGCACCCCACACGAGGCGGGG + Intergenic
1094514891 12:31120448-31120470 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094515066 12:31121045-31121067 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094515328 12:31122458-31122480 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094515359 12:31122538-31122560 GAGGCACCCCCCGCGAGGGGGGG + Intergenic
1094515477 12:31122854-31122876 GAGGCACCCCCCGTGAGGTGGGG + Intergenic
1094515507 12:31122933-31122955 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1095623209 12:44283017-44283039 TTGGCAGCTCCCACGTGGTGTGG + Intronic
1097821747 12:64134898-64134920 CCGGCAGGCCCCTGGAGGTGAGG - Intronic
1099859706 12:88211013-88211035 CTGGCAGACCCCAGGAGGTGAGG - Intergenic
1103624453 12:122207300-122207322 GCCTCAGCCCCCTCGAGATGTGG + Exonic
1104920058 12:132286019-132286041 GGGACTGCCCCCACGAGCTGCGG - Intronic
1104946494 12:132417038-132417060 GCGGCAGCCCCAAAGAGGCAGGG + Intergenic
1106547909 13:30746270-30746292 GCTGCAGCACCCACACGGTGGGG - Intronic
1107424716 13:40281586-40281608 CCGGCAGGCCCCTAGAGGTGAGG - Intergenic
1107940214 13:45376530-45376552 GAGGCACCCCCCACGAGGTAGGG - Intergenic
1107940409 13:45377369-45377391 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1107940490 13:45377606-45377628 GAGGCACCCCCCACGAGGTGGGG - Intergenic
1107940516 13:45377685-45377707 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1107940542 13:45377765-45377787 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1107940572 13:45377844-45377866 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1107941046 13:45380073-45380095 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1107941104 13:45380230-45380252 GAGGCACCCCCCACGAGGCTGGG - Intergenic
1107941132 13:45380309-45380331 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1107941461 13:45381525-45381547 GAGGCACCCCCTACGAGGCGGGG - Intergenic
1107941492 13:45381604-45381626 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1107941550 13:45381770-45381792 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1107941606 13:45381928-45381950 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1107941635 13:45382007-45382029 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1107941661 13:45382087-45382109 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1107941691 13:45382166-45382188 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1107941748 13:45382323-45382345 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1107941777 13:45382402-45382424 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1107942112 13:45383977-45383999 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1108053006 13:46464106-46464128 GAGGCACCCCCCACGAGGCAGGG + Intergenic
1108053036 13:46464185-46464207 GAGGCACCCCCCACGAGGCAGGG + Intergenic
1108053126 13:46464420-46464442 GAGGCACCCCCAACGAGGCGGGG + Intergenic
1108053157 13:46464499-46464521 GAGGCACCCCCCACGAGGCGGGG + Intergenic
1108053190 13:46464580-46464602 GAGGCACCCCCAGCGAGGTGGGG + Intergenic
1108053424 13:46465583-46465605 GAGGCACCCCCCACGAGGCAGGG + Intergenic
1108053860 13:46467420-46467442 GAGGCACCCCCCACGAGGCAGGG + Intergenic
1108053889 13:46467499-46467521 GAGACACCCCCCACGAGGCGGGG + Intergenic
1108676115 13:52739249-52739271 GCGGTAGCCCCCAGGGAGTGGGG + Intronic
1109537953 13:63741059-63741081 GAGGCACCCCCCACGAGGGAGGG - Intergenic
1109538106 13:63741536-63741558 GAGGCACCCCCCACGAGGCCGGG - Intergenic
1109538151 13:63741694-63741716 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1109538178 13:63741773-63741795 GAGGCAGCCCCCACGAGCCGAGG - Intergenic
1109546362 13:63840952-63840974 GAGGCAGCCCCCGCGAGCCGAGG + Intergenic
1109546493 13:63841348-63841370 GAGGCAGCCCCCACGAGGCGGGG + Intergenic
1109546515 13:63841428-63841450 GAGGCACCACCCGCGAGGTGGGG + Intergenic
1109546686 13:63842250-63842272 GAGGCAGCCCCCGCGAGCCGAGG + Intergenic
1109546712 13:63842329-63842351 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1109669138 13:65582367-65582389 GGGGCAGCCCTCTGGAGGTGGGG - Intergenic
1110891795 13:80705442-80705464 GAGGCACCCCCCACGAGGCGGGG + Intergenic
1110891976 13:80705993-80706015 GAGGCACCCCCAGCGAGGTGGGG + Intergenic
1110892004 13:80706072-80706094 GAGGCACCCCCCATGAGGTAGGG + Intergenic
1110892303 13:80707253-80707275 GAGGCACCCCCCGTGAGGTGTGG + Intergenic
1113710560 13:112461728-112461750 GCGCCTGCCCCCGAGAGGTGAGG - Intergenic
1115301782 14:31893272-31893294 ACAGCAGCCCTCACAAGGTGGGG + Intergenic
1121104910 14:91273479-91273501 GCGGCCTCCCCTCCGAGGTGGGG + Exonic
1122269742 14:100563453-100563475 GCGGCGTCCCCCAGGAGGTGTGG + Intronic
1124147397 15:27140262-27140284 GCGTCAGCCCTCACGGGTTGAGG - Intronic
1125508374 15:40280274-40280296 TCGGGAGCCCACACGAGCTGCGG - Intronic
1126823637 15:52528847-52528869 GCGGCCGCCCAGGCGAGGTGCGG - Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1132678269 16:1129616-1129638 GCGGCAGCCCGCACGGAGCGGGG - Intergenic
1132735895 16:1385762-1385784 GCGGGGGCACCCAGGAGGTGTGG - Intronic
1133097624 16:3458165-3458187 GCCGGCTCCCCCACGAGGTGAGG + Intronic
1138095347 16:54207015-54207037 TCTGCAGGCCCCAGGAGGTGAGG - Intergenic
1138266855 16:55665711-55665733 GGAGCAGCCCCCAGCAGGTGAGG - Intronic
1140481012 16:75262936-75262958 GCTGCAGCCCCCACAAGTAGAGG + Intronic
1141125781 16:81399854-81399876 GTGGCTGCCCCCAGGAGATGGGG - Intergenic
1141673140 16:85503302-85503324 GAGGCAGCCCCCAGGAGGGAAGG + Intergenic
1142601234 17:1053904-1053926 GCGGCAGCCCCCAAGAAGGGAGG + Intronic
1143456195 17:7069599-7069621 GAGGCAGCCCTCAGGAGGAGGGG + Intergenic
1144851843 17:18247745-18247767 GCGGCAGCGCGCACCAGGCGCGG + Exonic
1145934297 17:28705929-28705951 TTGCCAGCCCCCACGAGGAGTGG + Intronic
1147259445 17:39200333-39200355 GCGGCCGCAGCCATGAGGTGAGG + Exonic
1151505031 17:74522028-74522050 GCTGCAGCCCCTCGGAGGTGGGG + Exonic
1152593891 17:81229046-81229068 GCCCCAGCCCCCACCAGGCGGGG + Exonic
1152751809 17:82065745-82065767 GCGGCGGCCCCGGCGCGGTGCGG - Intronic
1156295827 18:35790186-35790208 GCAGCAGCCCTCAGGAGCTGAGG - Intergenic
1160453414 18:78980006-78980028 GCGGCCGCGCCGACGAGGAGGGG - Intergenic
1160919403 19:1512851-1512873 GCTGCAGCCCACACGGGGAGGGG - Intronic
1161312762 19:3603907-3603929 GCAGGGGCCCCCACGCGGTGGGG + Intronic
1163419000 19:17203791-17203813 GAGGCAGGGCCCACGAGGAGAGG - Intronic
1163613411 19:18312298-18312320 GGGGCAGCCCCCTCCAGGGGAGG - Intronic
1165453100 19:35896513-35896535 GCAGCAGCCGCCACCAGGAGAGG + Exonic
1166790649 19:45396681-45396703 GCGGCAGCCCCCTGGCGGAGGGG - Exonic
1166852597 19:45767699-45767721 GAGGCAGCCCCTACGCGGAGTGG + Intronic
1167439627 19:49500755-49500777 CCGGCAGGCCCCAAGGGGTGAGG - Intergenic
1168102728 19:54149573-54149595 GCGGCAGCCCCAACGGGGGCTGG + Exonic
924988210 2:289260-289282 GGGGCAGACCCCTCGAGGTCCGG - Intergenic
927145921 2:20166524-20166546 GGGTCAGCCCCCAGGAGATGGGG - Intergenic
927553227 2:24016637-24016659 GCTGGAGCTCCCACGAGGAGTGG + Intronic
929857850 2:45651244-45651266 GCGCCGGCGCCCAGGAGGTGGGG + Intergenic
930026025 2:47029612-47029634 TCCTCAGCCCCCATGAGGTGGGG + Intronic
938314276 2:130315362-130315384 TCGGCAGCCACCAGGAGGTAGGG + Intergenic
938854575 2:135296979-135297001 GAGGCAGCCCCCAGTAGGGGCGG - Intronic
948020905 2:234732571-234732593 GTGGCAGCCCTCAGGTGGTGGGG + Intergenic
948140784 2:235670506-235670528 CCGGCAGCCCCGACGTGGAGGGG + Intronic
1170811085 20:19675209-19675231 GCAGCAGCTCCCACGGGGTTGGG - Intronic
1175640628 20:60626937-60626959 GCGTCAGACCCCACCAGGTGAGG + Intergenic
1175847133 20:62065068-62065090 GCGGCGGCGCCCACGAAGGGGGG + Exonic
1175853123 20:62104404-62104426 GGAGAAGCCCCCACGTGGTGAGG + Intergenic
1175906206 20:62380844-62380866 CAGCCAGCCCCCAGGAGGTGTGG + Intergenic
1176089849 20:63313918-63313940 CCAGGAGGCCCCACGAGGTGGGG - Intronic
1177012440 21:15744876-15744898 GCGGCAGACCCGGCGGGGTGCGG - Intronic
1179119285 21:38528060-38528082 GCAGCAGCCCCCAGAAGCTGGGG - Intronic
1179320436 21:40286114-40286136 GCAGCAGCCTCCACCAGGTCAGG + Intronic
1179404434 21:41113534-41113556 CCGGCAGCCACCAAGAGCTGGGG - Intergenic
1180056717 21:45362767-45362789 ACAGCAGCCCCCAGGAGGGGTGG + Intergenic
1181539600 22:23566299-23566321 GCGGCCGACCCCACGCGGTCAGG - Intergenic
1182618328 22:31603696-31603718 GCTGCAGCCCCCACCCAGTGAGG - Intronic
1183506597 22:38212685-38212707 GGGGCAGCCCCCAGGAGGTTGGG + Intronic
1183603975 22:38858033-38858055 TGAGCAGCCCCCATGAGGTGAGG - Intergenic
1184609593 22:45594336-45594358 GGGGCAGTCCCCACCAGATGAGG + Intronic
1185330645 22:50250739-50250761 GGGGCAGGCCCCACGATGGGGGG - Intronic
949883466 3:8678495-8678517 GAGGCACCCCCCGCGAGGCGGGG + Intronic
949883522 3:8678653-8678675 GAGGCACCCCCCGCGAGGCGGGG + Intronic
949883576 3:8678815-8678837 GCGGCACTCCCCACGAGGCGGGG + Intronic
949883625 3:8678977-8678999 GAGTCACCCCCCGCGAGGTGGGG + Intronic
949883758 3:8679371-8679393 GAGGCATCCCCCAGGAGGAGGGG + Intronic
949884249 3:8681482-8681504 GAGGCAGCCCCCACGAGGCGGGG + Intronic
954802667 3:53196130-53196152 GCCGCAGACCCCAGGAGGGGAGG + Intergenic
957045047 3:75367082-75367104 GAGGCAGCCCCCGCGATGAGGGG - Intergenic
958252990 3:91291857-91291879 GAGGCAGCCCCCAGTAGGGGTGG + Intergenic
958817111 3:98928353-98928375 GAGGAAGCCCTCAGGAGGTGGGG + Intergenic
961824109 3:129589844-129589866 GGGGCAGCCCCAAGGGGGTGCGG - Intronic
962347172 3:134626566-134626588 GTGGCAGCCCTGACGACGTGTGG - Intronic
962657016 3:137557511-137557533 GAGGCACCCCCCAGGAGGGGTGG + Intergenic
969022559 4:4147857-4147879 GAGGCACCCCCCGCGATGTGGGG - Intergenic
969280220 4:6165952-6165974 CCGGCAGCCCTCAGGAGCTGGGG - Intronic
972201593 4:36719543-36719565 CCGGCAGACCCCTGGAGGTGAGG - Intergenic
975819466 4:78254931-78254953 GCACCAGCCCCCACGAGGGTTGG + Intronic
980957460 4:139443977-139443999 CCGGCAGGCCCCTAGAGGTGAGG + Intergenic
985806390 5:2047255-2047277 GCTGCAGCCCACATGAAGTGTGG + Intergenic
1001407210 5:171484573-171484595 GAGGCACCCCCCACCAGGTGGGG + Intergenic
1002963918 6:1943293-1943315 GGGACAGCCCCCACCAGGGGAGG - Intronic
1003885997 6:10521982-10522004 GAGGCAGGACCCAGGAGGTGGGG - Intronic
1005100883 6:22171760-22171782 GAGGCACCCCCCACTAGGGGTGG - Intergenic
1006450459 6:34103050-34103072 GTGACAGGCCCCAGGAGGTGAGG - Intronic
1009191495 6:60635190-60635212 GAGGCAGCCCCCAGTAGGGGTGG - Intergenic
1012730162 6:102871940-102871962 GTGGCAGGCCCCTAGAGGTGAGG + Intergenic
1014161787 6:118178166-118178188 TCCGCAACCCCCAGGAGGTGTGG - Intronic
1018705938 6:166462980-166463002 GCAGCAGCCTCCAGCAGGTGGGG - Intronic
1019645278 7:2125576-2125598 GCTACAACCCCCACCAGGTGAGG + Intronic
1020619628 7:10501678-10501700 GAGGCACCCCCCAGGAGGGGAGG + Intergenic
1029508608 7:100978573-100978595 TGGGGAGCCCCCACGGGGTGTGG - Intronic
1034303231 7:150033824-150033846 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1034303314 7:150034060-150034082 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034303463 7:150034803-150034825 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1034303490 7:150034883-150034905 GAGGCACCCCCCGCGAGGTAGGG - Intergenic
1034303873 7:150036140-150036162 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1034304113 7:150037134-150037156 GAGGCACCCCCCACGAGGCAGGG - Intergenic
1034304172 7:150037360-150037382 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304398 7:150038066-150038088 GAGGCACCCCCCGCGAGGTGGGG - Intergenic
1034304544 7:150038788-150038810 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304658 7:150039178-150039200 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304940 7:150040042-150040064 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034305234 7:150041535-150041557 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034305573 7:150042566-150042588 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034339181 7:150341193-150341215 GCGGCAGCCCCCGCGCCGGGAGG - Exonic
1034801272 7:154058086-154058108 GAGGCATCCCCCATGAGGCGGGG + Intronic
1034801576 7:154059034-154059056 GAGGGACCCCCCACGAGGCGGGG + Intronic
1034801601 7:154059114-154059136 GTGGCACCCCCCACGAGGGTGGG + Intronic
1034801629 7:154059196-154059218 GAGGCACCCCCCGCGAGGTAGGG + Intronic
1034801806 7:154060018-154060040 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1034801944 7:154060415-154060437 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1034802079 7:154060882-154060904 GAGGCACCCCCCACGAGGCGGGG + Intronic
1034802623 7:154062816-154062838 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1034802788 7:154063365-154063387 GTGGCACCCCCCACGAGGGTGGG + Intronic
1034802866 7:154063606-154063628 GAGGCACCCCCCACGAGGCAGGG + Intronic
1035250994 7:157596726-157596748 GCGGCTGCCTCCCCAAGGTGAGG - Intronic
1035373265 7:158392397-158392419 GCGTCAGCTCACACGAGGAGAGG + Intronic
1035466710 7:159084250-159084272 TTGGCAGGCCGCACGAGGTGTGG + Intronic
1039793800 8:40895837-40895859 GGGGCAGCCCCCAGCACGTGGGG - Intronic
1048654659 8:136522622-136522644 CCGGCAGGCCCCTAGAGGTGAGG - Intergenic
1049454971 8:142682148-142682170 GCTGCAGCCCACACTGGGTGTGG + Exonic
1049548527 8:143246062-143246084 GCGGCAGGGGCCACGTGGTGGGG + Intergenic
1049799500 8:144511247-144511269 GAGGCAACCCCCACAAGCTGGGG - Intergenic
1050512980 9:6413766-6413788 TGGGCAGCCCCCGCGAGGCGCGG + Intronic
1053736142 9:41104214-41104236 GAGGCACCCCCCGCGAGGAGGGG + Intergenic
1053736227 9:41104675-41104697 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736253 9:41104755-41104777 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736688 9:41107081-41107103 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736727 9:41107186-41107208 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053737030 9:41108408-41108430 GAGGCACCCCTCGCGAGGTGGGG + Intergenic
1053737055 9:41108488-41108510 GAGGCATCCCCCGCGAGGCGGGG + Intergenic
1053737083 9:41108568-41108590 GAGGCATCCCCCACGAGGCGTGG + Intergenic
1053737228 9:41108968-41108990 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1054691121 9:68322351-68322373 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691265 9:68322749-68322771 GAGGCATCCCCCACGAGGCGTGG - Intergenic
1054691293 9:68322829-68322851 GAGGCATCCCCCGCGAGGCGGGG - Intergenic
1054691318 9:68322909-68322931 GAGGCACCCCTCGCGAGGTGGGG - Intergenic
1054691344 9:68322989-68323011 GAGGCACCCCTCGCGAGGTGGGG - Intergenic
1054691591 9:68324056-68324078 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691646 9:68324214-68324236 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691683 9:68324319-68324341 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054692120 9:68326645-68326667 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054692147 9:68326725-68326747 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054692232 9:68327186-68327208 GAGGCACCCCCCGCGAGGAGGGG - Intergenic
1056723418 9:89090545-89090567 GAGGCTTCCCCCAGGAGGTGAGG + Intronic
1056868801 9:90256981-90257003 GCGGCAGACCCCCTGAGGTCGGG - Intergenic
1056918291 9:90763166-90763188 GAGGCACCCCCCACGATGCGGGG - Intergenic
1057798870 9:98177200-98177222 TCAGCAGCCCCCACGATGTGAGG + Intronic
1061040571 9:128138845-128138867 GAGGCACCCCCCACGAGGCGGGG - Intergenic
1061040708 9:128139243-128139265 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1061040841 9:128139644-128139666 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1061040870 9:128139724-128139746 GAGGCAACCCCCGCGAGTTGGGG - Intergenic
1061196920 9:129111615-129111637 GCGGCAGCCGCCGCCAGGTAAGG + Exonic
1062243423 9:135551619-135551641 CCCACCGCCCCCACGAGGTGAGG + Intergenic
1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG + Intronic
1062622074 9:137427681-137427703 GGGGGAGCCCCCATGGGGTGGGG + Intronic
1189332398 X:40152051-40152073 GCAGCGGTCCCCACGGGGTGGGG + Intronic
1192470295 X:71392647-71392669 GTGGCAGATCCCACGGGGTGTGG + Exonic
1199627385 X:149752997-149753019 CCGGCAGGCCCCTGGAGGTGAGG - Intergenic
1200146056 X:153926995-153927017 GGGGCAGCCCCCTCGGAGTGAGG + Intronic