ID: 1072716336

View in Genome Browser
Species Human (GRCh38)
Location 10:97755267-97755289
Sequence GGTTCAGGAGCAGAGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 299}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072716336_1072716344 0 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716344 10:97755290-97755312 TGGGTCCTGAGAGCAGGGCGAGG No data
1072716336_1072716341 -6 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716341 10:97755284-97755306 TGAACCTGGGTCCTGAGAGCAGG No data
1072716336_1072716348 13 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716348 10:97755303-97755325 CAGGGCGAGGGGAGCTGCTTTGG No data
1072716336_1072716345 1 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716345 10:97755291-97755313 GGGTCCTGAGAGCAGGGCGAGGG No data
1072716336_1072716346 2 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716346 10:97755292-97755314 GGTCCTGAGAGCAGGGCGAGGGG No data
1072716336_1072716349 14 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716349 10:97755304-97755326 AGGGCGAGGGGAGCTGCTTTGGG No data
1072716336_1072716350 15 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716350 10:97755305-97755327 GGGCGAGGGGAGCTGCTTTGGGG No data
1072716336_1072716342 -5 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716342 10:97755285-97755307 GAACCTGGGTCCTGAGAGCAGGG No data
1072716336_1072716351 16 Left 1072716336 10:97755267-97755289 CCTGCGGCCTCTGCTCCTGAACC 0: 1
1: 0
2: 2
3: 32
4: 299
Right 1072716351 10:97755306-97755328 GGCGAGGGGAGCTGCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072716336 Original CRISPR GGTTCAGGAGCAGAGGCCGC AGG (reversed) Intronic
900490911 1:2948727-2948749 GCTGCAGGAGCAGAGGGCACAGG - Intergenic
900500782 1:3003544-3003566 GGTCCAGTTGCAGAGCCCGCTGG + Intergenic
901059642 1:6466089-6466111 GGCTATGGAGCAGCGGCCGCGGG - Exonic
901748252 1:11388891-11388913 GTTTCATGATCAGAGGCTGCCGG - Intergenic
902334504 1:15747331-15747353 GGGTCAGGGGCAGAGGGAGCTGG + Intronic
903568306 1:24285332-24285354 TGTTCTGGAGCAGAGGCCACTGG + Intergenic
903647433 1:24903698-24903720 GGCTCAGGACCAGAGGCCCTAGG - Intronic
904698835 1:32346294-32346316 CGTTCAGGAGCAGCAGCCACAGG + Intergenic
905183111 1:36178561-36178583 GGAGCAGGAGCGGAGGCTGCAGG + Exonic
905477527 1:38239419-38239441 GGGTGAGGAGGAGAGGCCTCGGG - Intergenic
905906043 1:41619115-41619137 GGCACAGGAGCAGAGGAGGCTGG - Intronic
906185616 1:43859984-43860006 GGCACAGGAGCAGAGGCAGGGGG - Intronic
907238403 1:53067085-53067107 GGGTCAGGGGCAGGGGCAGCAGG + Intronic
909548158 1:76869168-76869190 GGATCCCGAGCAGTGGCCGCGGG - Intronic
912419041 1:109531131-109531153 GGTCAAGGAGCAGAGGCCCACGG + Intergenic
913231890 1:116746807-116746829 GGTATAGGAGCAGAGGTCGCAGG + Intergenic
914814905 1:151056192-151056214 GGTTAAGGAGCAGTGGCTGGTGG + Intronic
915250355 1:154583943-154583965 GCTTTAGGAGAAGAGGCAGCTGG + Exonic
917297415 1:173536140-173536162 TGGTCAGGAACAGAGGCAGCAGG - Intronic
917339646 1:173962026-173962048 GGTTCAGGAGCAGATGGTGGAGG + Exonic
920098673 1:203502967-203502989 GGCTCAGGGGCAAAGGCCCCGGG - Exonic
922706455 1:227793216-227793238 TGCTCTGGAGCAGAGGCCCCTGG - Intergenic
923100335 1:230809279-230809301 AGTGCAGAAGCAGAGGCCCCTGG - Intergenic
1062905731 10:1178401-1178423 GAGGCAGGAGCAGAGGCCACAGG - Exonic
1062989222 10:1800031-1800053 GGTTCTGGAGGAGAGGCCTGTGG + Intergenic
1063007646 10:1989229-1989251 GGTTCAGGGGCAGAGAGAGCGGG + Intergenic
1064128055 10:12681445-12681467 GCTGCAGGAGCGGAGGCTGCAGG - Intronic
1065022137 10:21509672-21509694 GGTTCAAGACCAGAGGCCCTGGG - Intergenic
1065153823 10:22849603-22849625 GGAGCTGGAGCAGAGGCTGCCGG + Intergenic
1065918039 10:30368474-30368496 GGAGCAGGAGGAGAGGCTGCTGG - Intronic
1067041229 10:42954291-42954313 GGTTCAGGGGCACAGCACGCAGG - Intergenic
1067306468 10:45069321-45069343 GGTTTAGGAGCAAAGGTCACTGG + Intergenic
1067577643 10:47418403-47418425 GGGTCAGGAGCAGGGCCGGCAGG - Intergenic
1069599784 10:69696402-69696424 GGTTTGGGAGCAGTGGCCTCAGG + Intergenic
1069742416 10:70693380-70693402 GGCTCAGGAGGGGAGCCCGCAGG - Intronic
1070992649 10:80746011-80746033 GGGTTAGGAGCAGATGCTGCAGG + Intergenic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1073330811 10:102668935-102668957 GTTTCAGGAGCAGTGGCAGGCGG + Intergenic
1077001729 11:326782-326804 GGGGCAGGAGCAGTGGCCACTGG - Intronic
1077206068 11:1345106-1345128 GGTGCAGGTGCAGATGCCCCAGG + Intergenic
1077281429 11:1747926-1747948 GGCTCAGGGGCAGGGGCCGCCGG + Exonic
1077317961 11:1927661-1927683 GGGGCAGGAGCAGAGGAGGCAGG + Intronic
1077398671 11:2341122-2341144 GGTTTGGGAGCAGAGGTCACTGG + Intergenic
1077740369 11:4839530-4839552 GGTTCTGGAACAAAGGCCTCAGG - Intronic
1078057030 11:8017376-8017398 GGATCAGGAGCAGTAGCCTCTGG + Intergenic
1081680335 11:44998164-44998186 GAGGCAGGAGCAGAGGCCGTAGG - Intergenic
1081786263 11:45749988-45750010 GGTCCAGGATCAGAGGCACCAGG - Intergenic
1083259009 11:61513193-61513215 GATTCAGGGGCAGAGGCCAAGGG + Intergenic
1083922526 11:65788304-65788326 CGTTCAGGGGAAGATGCCGCTGG - Intronic
1084085469 11:66853080-66853102 GGTGCAGGACAAGAGGACGCAGG + Intronic
1084154299 11:67304971-67304993 GGTACAGCTGCTGAGGCCGCAGG + Exonic
1084876167 11:72135432-72135454 GGTCCCGGAGCAGATGCTGCGGG - Intronic
1084881031 11:72171911-72171933 GGTCCTGGAGCAGATGCTGCGGG - Intergenic
1086944422 11:92831048-92831070 TGTTCAGGAGCAGAAGCCAGAGG + Intronic
1087640041 11:100746733-100746755 GGTTTAGGAGCAGAGGTCACTGG - Intronic
1087729737 11:101765223-101765245 GCTTCTGGAGCAGAGGCTGCTGG - Intronic
1088258789 11:107926010-107926032 GGCTGAGGAGCAGAAGCCACTGG + Intronic
1089140936 11:116283370-116283392 GGTGCAGGAGCAAAGACCACGGG - Intergenic
1089511156 11:118998127-118998149 GGGTCAGGGTCAGAGGCCGCCGG + Exonic
1089848688 11:121479054-121479076 GGTACAGGTTCAGAGGCCGGGGG - Intronic
1091154746 11:133362290-133362312 GACTCTGGAGCACAGGCCGCGGG + Intronic
1092260698 12:6951931-6951953 GGTGCAGGAGTAGAGGCAGGAGG - Intronic
1092347930 12:7731605-7731627 TGTCCAGCAGCAGAGGCCTCTGG + Intronic
1094819120 12:34211222-34211244 GGGTCCGGGGCAGAGGCTGCTGG + Intergenic
1095096501 12:38152196-38152218 GGTTCCAGCGCAGAGGCTGCTGG - Intergenic
1095096644 12:38152777-38152799 GGTTCTGGCACAGAGGCTGCTGG - Intergenic
1095097275 12:38155405-38155427 GGTTCCGGCGCAGAAGCTGCCGG - Intergenic
1096541688 12:52311443-52311465 GCTTCCGGAGAAGAGGCAGCTGG + Intergenic
1099061978 12:77922633-77922655 GGTTGAGGAACACAGGCCGAGGG - Intronic
1102567214 12:113804598-113804620 GCTTCTGGAGCAGAAGCCGTTGG - Intergenic
1102966936 12:117135152-117135174 TATTCAGGAGCAGAGGCAGGAGG - Intergenic
1104589920 12:130075914-130075936 GGTGGAGGAGCAGAGGGAGCAGG + Intergenic
1104644824 12:130489593-130489615 GAGTCAGGAGCAGAGACCGTGGG - Intronic
1105941150 13:25149193-25149215 GGGGCAGGAGCAGAGGTGGCAGG - Intergenic
1106099938 13:26685704-26685726 GGTGCAGGAGCAGCGGGAGCAGG + Exonic
1106857496 13:33868887-33868909 ATTCCAGGAGCAGAGGCCACGGG - Intronic
1112197367 13:97238841-97238863 GATTCATGAGCTGAGGCCACTGG + Intronic
1112305275 13:98267771-98267793 GGCCCAGGATCAGAGGCCCCAGG - Intronic
1113220340 13:108094243-108094265 ATTTCAGGAGCAGAAGCCACAGG + Intergenic
1113636180 13:111920531-111920553 GTTCCAGGAGGAGGGGCCGCAGG - Intergenic
1114223970 14:20722207-20722229 GGTTCAGGAGCGGAGCCGGCCGG - Intergenic
1117164851 14:53023012-53023034 GCTTTAGGAGCTGAGGCAGCTGG + Intergenic
1117253216 14:53955023-53955045 GGTCCGGGTGCGGAGGCCGCGGG + Intronic
1118612986 14:67555830-67555852 GGAGCTGGAGCAGAGGCTGCTGG + Exonic
1119400913 14:74361626-74361648 TGTTCAAGACCAGAGGCAGCTGG - Intergenic
1122113394 14:99516306-99516328 GGGTCAGGGGCAGAGGCCACCGG + Intronic
1122123096 14:99565034-99565056 GCTGCATGATCAGAGGCCGCGGG - Intronic
1122449844 14:101796840-101796862 ACTTGAGGAGCAGAGGCAGCAGG - Intronic
1122826845 14:104374696-104374718 GGCCCAGGAGGAGAGGCCCCTGG + Intergenic
1122871534 14:104641079-104641101 GGGTCAGGAGCAGAGGGTGCTGG + Intergenic
1123470419 15:20547410-20547432 GGTTCAGAAACAGAGGCTGATGG - Intergenic
1123647638 15:22453290-22453312 GGTTCAGAAACAGAGGCTGATGG + Intergenic
1123682200 15:22770813-22770835 GTGACAGGAGCAGAGGCTGCGGG - Intergenic
1123730720 15:23142387-23142409 GGTTCAGAAACAGAGGCTGATGG - Intergenic
1123748859 15:23339813-23339835 GGTTCAGAAACAGAGGCTGATGG - Intergenic
1124281231 15:28363696-28363718 GGTTCAGAAACAGAGGCTGATGG - Intergenic
1124301472 15:28547925-28547947 GGTTCAGAAACAGAGGCTGATGG + Intergenic
1124333944 15:28843308-28843330 GAGACAGGAGCAGAGGCTGCGGG - Intergenic
1125348458 15:38742925-38742947 GTTACAGGAGCAGAGGCCTCTGG - Intergenic
1125487514 15:40122718-40122740 GGTGAAGGAGCAGAGGTCACAGG - Intergenic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1125889759 15:43256773-43256795 GGTTCTGGAGCAAGGGCCCCTGG + Intronic
1128159119 15:65411418-65411440 GACTCAGGAGCAGAGGCTGTGGG - Intronic
1128616416 15:69114070-69114092 GGCTCAGTCGCAGAGGCAGCAGG - Intergenic
1128721807 15:69955674-69955696 GGGTCACGAGCTGAGGCCTCGGG + Intergenic
1128730117 15:70015199-70015221 GGTTCAGGAAGAGAGGCTGGAGG + Intergenic
1128978221 15:72168420-72168442 GGCTCCAGAGCAGAGGCCCCTGG + Intronic
1129029750 15:72609625-72609647 GGAGCAGGAGGAGAGGCTGCGGG + Intergenic
1129029788 15:72609826-72609848 GGAGCAGGAGCAGAGGCTGAGGG + Intergenic
1129029792 15:72609847-72609869 GGAGCAGGAGGAGAGGCTGCTGG + Intergenic
1129109846 15:73330887-73330909 GGCTCAGCAGTAAAGGCCGCTGG - Intronic
1130091454 15:80824504-80824526 GGGTCTGGAGCAGAGGATGCTGG - Intronic
1130576107 15:85094603-85094625 GGTCCATGAGCAGAGACAGCAGG - Intronic
1131250473 15:90827048-90827070 GCTTCAGAAGCAGCGGGCGCTGG + Intergenic
1131540471 15:93271045-93271067 GGGGCAGCAGCAGAGGCTGCTGG + Intergenic
1131855117 15:96585462-96585484 AGCTCAGCAGCAGAGGCCCCCGG - Intergenic
1132246976 15:100305116-100305138 GGTGCAGGAGCAGAGGGGGAGGG + Intronic
1132586848 16:709299-709321 GGATGAGGACCAGAGGCTGCTGG + Intronic
1136280237 16:29204070-29204092 GGTGCAGGAGCACAGGCTGGAGG + Intergenic
1136711628 16:32241478-32241500 GCTGCAGGAGCAGAGGACGGTGG + Intergenic
1137339502 16:47586317-47586339 GGTTCAGCAGCAGCTGCCGCTGG - Intronic
1137791000 16:51174667-51174689 GGTTCAGGAGCAGAAAGGGCTGG - Intergenic
1139215467 16:65122005-65122027 GGCCGAGGAGCAGATGCCGCGGG - Exonic
1139347797 16:66315524-66315546 GGTCCAGGAGCAGTGCCCGGAGG - Intergenic
1141583876 16:85020018-85020040 AGTACAGGAGCAGAGCCAGCTGG + Intergenic
1141615748 16:85208477-85208499 GAGTCAGGAGCTGAGGCAGCAGG - Intergenic
1141737106 16:85861050-85861072 GGTTGGGGAGCAGAGGCTGCAGG + Intergenic
1142108217 16:88317596-88317618 GGTTGAGGGGCAGTGCCCGCCGG + Intergenic
1142282790 16:89157170-89157192 GGGTCAGGAGCAGGAGCCTCAGG + Intergenic
1203058426 16_KI270728v1_random:948281-948303 GCTGCAGGAGCAGAGGACGGTGG - Intergenic
1142580352 17:938116-938138 GGTTAAGGGGCAGAGGCCCCAGG + Intronic
1142878336 17:2865981-2866003 GCTTCAGGAGCATGGGCTGCTGG - Intronic
1143490802 17:7284252-7284274 GGCCCAGGAGCAGTGGCCACAGG - Exonic
1143877498 17:10003231-10003253 GGTTCCGCAGCAGAGACCGCAGG + Intronic
1146106245 17:30039792-30039814 GGTTTAGGATCAGAGGTCACTGG + Intronic
1146290206 17:31601267-31601289 GGGTCAGGAGCCAAGGCGGCAGG + Intergenic
1146742539 17:35299145-35299167 GGTTGAGGAGCAGATGCAGGGGG - Intergenic
1147263365 17:39221656-39221678 GGCTCAGCAGCCGAAGCCGCTGG - Intronic
1147375216 17:40018965-40018987 GGAAGAGGAGCAGAGGCGGCAGG - Intergenic
1147947543 17:44088503-44088525 GGCTCAGGGGCCGATGCCGCGGG + Exonic
1149088920 17:52753510-52753532 GTTTCAGGAACAGAGGACACAGG + Intergenic
1149774167 17:59344222-59344244 GGTTCAGGAGTAGAAGGCACAGG + Intronic
1150455553 17:65304138-65304160 GGGTCAGCAGCAGAGGCAGGAGG - Intergenic
1151517704 17:74606920-74606942 CGTTCAGTTGCAGAGGCCCCAGG + Intergenic
1151681618 17:75625599-75625621 GGGTCAGGAGCTGAGACGGCTGG + Intergenic
1151835144 17:76577867-76577889 GTCTTAGGAACAGAGGCCGCTGG - Intronic
1152072489 17:78140836-78140858 GGTTCAGGAGAAGTGGCACCTGG + Exonic
1152334318 17:79691728-79691750 GGTTCCAGAGCACAGGCTGCAGG + Intergenic
1152352196 17:79790215-79790237 CGTTCAGGACCCGAGGCTGCGGG + Intergenic
1152427946 17:80228819-80228841 GCTTCAGGCGCGGAGGCTGCAGG + Intronic
1152558197 17:81065095-81065117 GGATGAGGAGCAGACGCCCCTGG - Intronic
1152702078 17:81824176-81824198 GGGGCAGGGGCAGGGGCCGCAGG + Intronic
1152733589 17:81985769-81985791 GGTTCATGAGCAGCAGCCTCGGG + Intronic
1152937037 17:83145187-83145209 CGTGCTGGAGCAGAGGCTGCAGG - Intergenic
1155893490 18:31294567-31294589 GGGCGAGGAGCAGAGGCGGCAGG - Intergenic
1156340044 18:36202534-36202556 GGGTCAGGGCCAGAGGCAGCTGG + Intronic
1156403622 18:36762328-36762350 GGTTCTGGAGCACAGCCTGCAGG - Intronic
1157571489 18:48715184-48715206 GCATCAGGAGCAGAGTCTGCAGG - Intronic
1158606599 18:58901470-58901492 GGTTCAGAAGTAGAGGCTGTGGG + Intronic
1159208617 18:65286266-65286288 GGATCAGGAACAGTGGCCCCAGG + Intergenic
1160096742 18:75880343-75880365 TTTTCAAGAGCAGAGGCTGCAGG - Intergenic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1162019655 19:7862777-7862799 GGGTCAGGAGGCGTGGCCGCGGG - Intronic
1162833182 19:13299511-13299533 GGTTCTTGAGCAGAGGAGGCTGG - Intronic
1163235780 19:16029625-16029647 GGGACAGGAGCAGAGGGCGGGGG + Intergenic
1163676873 19:18659821-18659843 GGATCAGGAGCAGAGGGAGGTGG - Intronic
1163929301 19:20373808-20373830 GATTTAGGAGCAGAGGTCACTGG + Intergenic
1164156438 19:22600322-22600344 GGAGCAGGAGGAGAGGCTGCTGG + Intergenic
1164853790 19:31505100-31505122 TGTTCAGGAGCAAATGCCACTGG + Intergenic
1165224158 19:34342346-34342368 GGTTCTGGGACAGAAGCCGCAGG + Exonic
1165749403 19:38251138-38251160 GGGACATGAGCAGAGGCCACAGG + Intronic
1166097525 19:40550243-40550265 GGTTCAGGAGCGGCTGCCACTGG + Exonic
1166316472 19:41992457-41992479 GGCCCAGGCGCAGAGGCTGCGGG - Intronic
1166531625 19:43546514-43546536 GACTCAGGAGCCCAGGCCGCAGG + Intronic
1166737703 19:45095936-45095958 GTTTCAAGAGCAGAGGCTCCAGG + Intronic
1166939840 19:46355926-46355948 GGGTAAGGAGCAGGGGCTGCAGG + Intronic
1167305050 19:48703399-48703421 GGTCCAGGAGCAGGGGTAGCCGG - Exonic
1167906876 19:52668478-52668500 GGTTTAGGAGCAGAGGTCACTGG + Intronic
1168694431 19:58396614-58396636 GGCCCAGGCGCAGAGGCGGCGGG - Exonic
925128361 2:1477380-1477402 GGCTCGGGCGCACAGGCCGCAGG - Exonic
925442774 2:3902880-3902902 GGTTCAGGAAAAGTGGCTGCAGG + Intergenic
926138375 2:10353462-10353484 GGTTCAGGGCCAGTGGCCCCTGG + Intronic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
930487448 2:52026144-52026166 GGTGGAGGAGCAGAGGCTGGGGG + Intergenic
931645278 2:64416625-64416647 GTGTTAGGAGCAGAGGCAGCAGG - Intergenic
931986883 2:67750804-67750826 GGTTCAGGGGCAGGGGGCTCTGG + Intergenic
932573152 2:72948771-72948793 GGATCAGGAGCAGGGGCCCCAGG + Intronic
933017716 2:77150709-77150731 GGCTCAGGAGCAGAGGTGGTTGG + Intronic
935634079 2:105236772-105236794 GGTCCAGGTGCAGAGGCACCGGG + Intergenic
936037775 2:109126625-109126647 GGTTGGGAAGCAGAGGCAGCTGG + Intergenic
937057260 2:118949539-118949561 GGTTTAGGAGCAGAAGTCACTGG - Intronic
945249180 2:207749114-207749136 GCTTCAGGAGCAGTGGTGGCAGG + Intronic
946037500 2:216755599-216755621 GGTTGAGGAGGAGAGGCCGTGGG + Intergenic
946362929 2:219229778-219229800 GGCTCAGGTGCGGACGCCGCCGG + Exonic
946363743 2:219235791-219235813 GGAACAGCAGCAGAGGCAGCAGG + Exonic
946400671 2:219466769-219466791 GGTGCAGGAGCAGGGGCAGGGGG + Intronic
946643039 2:221804678-221804700 GGTTCTGCAGCAAAGGCCTCTGG + Intergenic
948394080 2:237631957-237631979 GGATCAGGGCCCGAGGCCGCAGG - Intronic
1173082913 20:39886868-39886890 GGTTTTGAAGCAGAGGCAGCAGG - Intergenic
1173143208 20:40502875-40502897 TGTTCCTGGGCAGAGGCCGCTGG - Intergenic
1173258622 20:41413433-41413455 GGCTCAGGAGCCGAGGTGGCAGG + Exonic
1173277605 20:41598200-41598222 GGTATGGGAGCAGAGGTCGCAGG + Intronic
1174898665 20:54475990-54476012 GGATCCGGAGCAGACGCCTCGGG + Exonic
1175760350 20:61558524-61558546 GGGGCAGGTCCAGAGGCCGCAGG - Intronic
1175820801 20:61907751-61907773 GGCTCAGGAACAGAGACAGCTGG + Intronic
1176100917 20:63364110-63364132 GGTGCAGGGGAAGAGGCCGTGGG + Intronic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1176844984 21:13869789-13869811 GGTGCAGGAGCTGGGGCAGCCGG + Intergenic
1178400175 21:32278771-32278793 GGCTGCGGAGGAGAGGCCGCTGG - Exonic
1178837088 21:36107949-36107971 GGTTTAGGAGCAGAGGTCACTGG + Intergenic
1179488677 21:41726902-41726924 TGCTCTGGAGCAGAGGCCGATGG + Intergenic
1180078900 21:45477494-45477516 GGTTCAGGAGCACAGGGAGGTGG - Intronic
1180220711 21:46356223-46356245 GGGTGAGGGGCTGAGGCCGCGGG + Intronic
1180867936 22:19130114-19130136 TGTTTGGGAGCAGAGGCGGCAGG - Intergenic
1182075736 22:27494292-27494314 GGGACAAGAGCAGAGGCCTCGGG + Intergenic
1183145144 22:35983303-35983325 GGTTCAAGAGCAGATGCCCCTGG - Intronic
1184376935 22:44119461-44119483 GGTTCAGGATGGGAGGCAGCAGG + Intronic
1184430800 22:44440708-44440730 GGTTTAGCACCAGAGGCTGCTGG + Intergenic
1185246217 22:49774727-49774749 GGCCCTGGAGCAGAGGCCGGTGG + Intronic
1185377904 22:50490679-50490701 GGTTCAGGGGTGGTGGCCGCAGG - Intergenic
949530127 3:4947411-4947433 AGTTCAGAAACAGAGGCCCCAGG - Intergenic
949721813 3:6998590-6998612 GGTGCAGGAGCAGAGCCCTCAGG - Intronic
950418153 3:12880389-12880411 GGTGCAGATGCAGAGGCAGCTGG + Intergenic
950424737 3:12919071-12919093 GGCTCAGGATGAGAGGCCCCGGG + Intronic
950427461 3:12932149-12932171 GGTACAGGAGCAGGAGACGCTGG + Intronic
953407869 3:42668542-42668564 GGCTCTGGGGCAGAGGCCTCTGG + Intergenic
954702501 3:52457659-52457681 GGGTCAGGTGCAGAGGCTGGTGG + Intronic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
960673077 3:120170554-120170576 GCTTCAGGAGGAGAGGCTGGTGG - Intronic
962240252 3:133746086-133746108 GAGTCAGGAGCAGAGCCCCCCGG + Exonic
963906771 3:150779432-150779454 GGCTCAGGAGCAGAGGGCGCTGG + Intergenic
964328408 3:155573664-155573686 GGTTCTGGAGCCTAGGCCTCAGG - Intronic
964569751 3:158098263-158098285 GGTTCAGGCGCAGCTGCAGCTGG - Exonic
964611991 3:158624906-158624928 GGCTTAGGAGCAGAGGCCAATGG - Intergenic
968920440 4:3519556-3519578 TGTTCTGGAGCAGGAGCCGCTGG + Intronic
968985576 4:3872694-3872716 GGCTCAGGAGGGGAGGGCGCTGG - Intergenic
973887939 4:55341700-55341722 GGTCTAGGAGCAGAGGTCACTGG + Intergenic
975668556 4:76757029-76757051 GGTTCAGGAGCTGTGGCAGTAGG - Intronic
979468577 4:121070547-121070569 GGTTCAGGAAGCGAGGCAGCAGG + Intronic
980255100 4:130370292-130370314 GGATCAGCAGCAGAGGCAGCAGG + Intergenic
982018012 4:151174925-151174947 TCTTCAGCAGCAAAGGCCGCGGG + Exonic
982137480 4:152285375-152285397 GGCTCAGGAGCAGTGGCAGCGGG + Intergenic
985652403 5:1112942-1112964 GGTTCTAGGGCAGGGGCCGCGGG - Intergenic
986187650 5:5459833-5459855 GGTTCTGGAGCAGAGGTGGCTGG + Intronic
986253777 5:6084612-6084634 GCTTCCGGAGCAGAGGCAGGAGG + Intergenic
986392815 5:7301345-7301367 GAGACAGGAGCAGAGGCTGCGGG - Intergenic
986707612 5:10464365-10464387 GGTGCAGAAGCAGAGGCTGTGGG - Intronic
987082541 5:14438593-14438615 GGTTCAGGAGAAGACGACACAGG - Intronic
989226221 5:39032670-39032692 GGTTCATGAGCAGAAACTGCTGG + Intronic
990210545 5:53478918-53478940 GGTGCAGGTGCGGCGGCCGCGGG + Intergenic
991972701 5:72156255-72156277 GGTTGAGGAGCAGAGGTGGTTGG - Intronic
992887897 5:81177032-81177054 GGTTCAGGAGAAGAAGCCCCAGG - Intronic
993055105 5:82971859-82971881 GGTTTAGGAGCAGAAGTCACTGG - Intergenic
996101171 5:119447337-119447359 GGTTTAGGAGTAGAGGTCACTGG + Intergenic
998150767 5:139756302-139756324 GGTTGGGGCGCAGAGGCAGCCGG + Intergenic
1000336633 5:160246140-160246162 GGGTCAGGAGCACAGGATGCTGG + Intergenic
1001087600 5:168712351-168712373 GGTTCTGAAGCAGAGGGCACAGG + Exonic
1001932926 5:175685981-175686003 GGTGAAGGAGCAGAGGGCCCAGG - Exonic
1004634581 6:17454460-17454482 TGTTTGGGAGCAGAGGCTGCAGG - Intronic
1005307815 6:24530700-24530722 GGTTGGGGAGAAGAGGCTGCTGG + Intronic
1005962525 6:30704198-30704220 GGCTCAAGATCAGAGGCTGCTGG + Exonic
1006100019 6:31680832-31680854 GGGTCAAGAGTGGAGGCCGCCGG + Intronic
1009842307 6:69092975-69092997 GGTTCAGGAGGAGAGGGAGTAGG + Intronic
1011211939 6:84964805-84964827 GGCTCAGGAGCAGAGGCCAATGG - Intergenic
1011449799 6:87480658-87480680 GGTTTAGGAGCAGAAGTCACTGG - Intronic
1011614616 6:89186433-89186455 GGGGCAGGAGCGGATGCCGCAGG - Intronic
1019212589 6:170418594-170418616 GGAGCAGGAGCACAGGCCACGGG - Intergenic
1019262785 7:91509-91531 GGGTCAGGAGCAGGGGCACCAGG + Intergenic
1019314544 7:378520-378542 GGTTCAGGAGCTGGCACCGCCGG - Intergenic
1019324087 7:429540-429562 GGTGCAGGAGGGGAGGCCCCAGG - Intergenic
1019392846 7:799096-799118 TGGTCAGGAGCAGAGGCCCCTGG - Intergenic
1019602671 7:1893125-1893147 GGGAGAGGAGCAGAGGCAGCAGG + Intronic
1021716688 7:23468732-23468754 GGTTGGGGAGCAGGGTCCGCTGG + Intronic
1021737938 7:23657388-23657410 GGCTTAGGAGCAGAGGCCAATGG + Intergenic
1022113773 7:27246229-27246251 GAGGCAGGAGCAGGGGCCGCCGG - Exonic
1022510956 7:30934488-30934510 GGTGTAGGAGCAGAGGCCAGAGG + Intergenic
1022522347 7:31016409-31016431 AGGTCAGGAGCAGAGGCAGGTGG - Intergenic
1023834267 7:44059215-44059237 AGTGCAGGAACAGAGGCCCCAGG - Intronic
1023966297 7:44964751-44964773 GCTTCAGGAGCAGTGGCCTTCGG - Intronic
1024161603 7:46681989-46682011 GATGCAGGAGCAGAGGGCGTGGG + Intronic
1024458063 7:49631355-49631377 GATCCAGAAGCAGAGGCTGCAGG - Intergenic
1027438644 7:78194739-78194761 GTTTCAAGAGCAGAGCCAGCTGG - Intronic
1027596555 7:80181484-80181506 GGTGGAGGACCAGAGGCCACAGG - Intronic
1029459726 7:100687757-100687779 GGGCCAGGAGCTGAGGCTGCGGG - Intronic
1029702307 7:102255109-102255131 TGGTGAGGAGCACAGGCCGCCGG - Exonic
1031919660 7:127591413-127591435 GGAGCAGGAGCAGAGGCCTGTGG - Exonic
1032074049 7:128827900-128827922 TGTTCAGGTGGAGAGGCCGGAGG - Intergenic
1032666994 7:134046721-134046743 GGTTCAGAAGAAGAGGCCATGGG - Intronic
1033166325 7:139041527-139041549 AGTTCAGGTGCAGAGTCTGCAGG - Intergenic
1034425278 7:151010701-151010723 GGGGCTGGAGCAGAGGCAGCTGG - Exonic
1035070858 7:156143992-156144014 TGTTCAGGAGGACAGGCCTCTGG + Intergenic
1035664837 8:1373286-1373308 GTGTCGGGAGCAGGGGCCGCGGG + Intergenic
1036700093 8:11007739-11007761 GGTGGAGGAACAGAGGCAGCAGG + Intronic
1036786666 8:11692624-11692646 GGCTGAGGCGCAGAGGCCGCGGG - Intronic
1037589801 8:20303342-20303364 GCCGCAGGAGCAGGGGCCGCAGG - Intronic
1037764058 8:21761039-21761061 GGTCCAGGAGCAGAGACTCCAGG + Intronic
1040108083 8:43551230-43551252 GGTTCAGGCGCAGGGCCTGCTGG + Intergenic
1040603899 8:48910857-48910879 CGCGCAGGAGCAGAGGACGCTGG + Intergenic
1040621983 8:49101549-49101571 GGTTTAGGAGCAGAGGCCACTGG + Intergenic
1040940373 8:52826648-52826670 TGTTCAGGTGCAGAGGAGGCTGG - Intergenic
1041919812 8:63168901-63168923 GGTGAGGGAGCAGAGGCCCCAGG + Exonic
1047444841 8:124910425-124910447 GGTTTAGGAGCAGAGGTCACTGG + Intergenic
1049411925 8:142477412-142477434 GGTGCTGGAGCAGAGGCTCCAGG - Exonic
1050204339 9:3181448-3181470 GGCTCAGGAGCAGAGGCGCTTGG - Intergenic
1053456112 9:38234163-38234185 GGGTCAGGAGCAGGAGACGCTGG + Intergenic
1057952946 9:99384557-99384579 TGTTCAGGAGCAGCGGTCACTGG + Intergenic
1058893952 9:109383913-109383935 GGTGCAGGAGGAGGGGCCGTTGG - Intronic
1059148584 9:111926033-111926055 GGCTCAGGAGCAGAGGCTAAAGG - Intronic
1059527860 9:115008774-115008796 TGGTCAGGAGCTGAGGCTGCAGG + Intergenic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1060201389 9:121653593-121653615 GGTGCAGAAGGAGAGGCCCCAGG - Intronic
1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG + Exonic
1061063102 9:128260626-128260648 GGAGCAGGAGGAGAGGCTGCTGG - Exonic
1061447675 9:130650433-130650455 GGACCAGGAGCAGAAGCCACGGG + Intergenic
1061860954 9:133468587-133468609 GATCCAGCAGCAGAGGCAGCAGG + Exonic
1061867192 9:133498938-133498960 GGTTCTGGAGCTGGGGCTGCAGG + Intergenic
1061957972 9:133973456-133973478 GGGTCAGGACCAGAGGCCAGCGG - Intronic
1062013948 9:134281943-134281965 GGCTCAGATGCAGAAGCCGCAGG + Intergenic
1062103749 9:134741590-134741612 GGTACAGAAGCAGAGGCAGGAGG + Intronic
1062454437 9:136629064-136629086 GGGTCAAGGGCAGAGGCCGTGGG - Intergenic
1062531045 9:137000526-137000548 GAATCAGGAGCAGGGGCTGCAGG - Intergenic
1062679845 9:137773264-137773286 GGTTCAGGACCAGCGGCTGCAGG - Intronic
1185460672 X:331601-331623 GGGGAAGGAGCAGAGGCCGGAGG - Intergenic
1190726595 X:53194173-53194195 GGGTCAGAAGCAGGGGCTGCAGG + Exonic
1191255534 X:58278020-58278042 GGGTCAGGCGCAGGGGCTGCCGG + Intergenic
1191889923 X:65929246-65929268 GGTTTTGGAGCAGAGGTCACTGG - Intergenic
1198518624 X:137430902-137430924 GGTTCAGAAGCAGTGACCACAGG + Intergenic
1199699687 X:150365828-150365850 GGGTTAGGTGCAGAGGCAGCAGG - Intronic
1199716019 X:150507867-150507889 GGTTCAGGGGCAGGGGCAGATGG - Intronic
1200093813 X:153648004-153648026 GGAGCAGGAGCCGCGGCCGCGGG - Exonic
1201764673 Y:17566095-17566117 GGTTCTGGCACAGAGGCTGCTGG + Intergenic
1201764762 Y:17566490-17566512 GGTTCCGGCGCAGAGGCTGCTGG + Intergenic
1201836791 Y:18339500-18339522 GGTTCCGGCGCAGAGGCTGCTGG - Intergenic
1201836880 Y:18339895-18339917 GGTTCTGGCACAGAGGCTGCTGG - Intergenic