ID: 1072717806

View in Genome Browser
Species Human (GRCh38)
Location 10:97763076-97763098
Sequence CTGGGGATTCCGGATTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072717800_1072717806 0 Left 1072717800 10:97763053-97763075 CCATTCTCTGGCACAGCTGGGGG No data
Right 1072717806 10:97763076-97763098 CTGGGGATTCCGGATTCCCCTGG No data
1072717795_1072717806 15 Left 1072717795 10:97763038-97763060 CCAGAGCAGCACATTCCATTCTC No data
Right 1072717806 10:97763076-97763098 CTGGGGATTCCGGATTCCCCTGG No data
1072717794_1072717806 16 Left 1072717794 10:97763037-97763059 CCCAGAGCAGCACATTCCATTCT No data
Right 1072717806 10:97763076-97763098 CTGGGGATTCCGGATTCCCCTGG No data
1072717793_1072717806 17 Left 1072717793 10:97763036-97763058 CCCCAGAGCAGCACATTCCATTC No data
Right 1072717806 10:97763076-97763098 CTGGGGATTCCGGATTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072717806 Original CRISPR CTGGGGATTCCGGATTCCCC TGG Intergenic
No off target data available for this crispr