ID: 1072718562

View in Genome Browser
Species Human (GRCh38)
Location 10:97767228-97767250
Sequence GAGGGTAAGGGAAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1609
Summary {0: 1, 1: 0, 2: 10, 3: 138, 4: 1460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072718562_1072718574 9 Left 1072718562 10:97767228-97767250 CCCTCCACCTTTCCCTTACCCTC 0: 1
1: 0
2: 10
3: 138
4: 1460
Right 1072718574 10:97767260-97767282 GCCTACTTTCTGAGACCCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072718562 Original CRISPR GAGGGTAAGGGAAAGGTGGA GGG (reversed) Exonic
900084978 1:888560-888582 GAGGGAAAGGGAAAGAAGGAAGG + Intergenic
900158650 1:1213308-1213330 GAGGGGTAGGGAAGGGTGGCTGG - Intronic
900503198 1:3016609-3016631 GAGAGGAAGGGAAAGAGGGAGGG + Intergenic
901224190 1:7602158-7602180 GAGGGGAAGGGAAGGGAGGAGGG - Intronic
901413180 1:9099153-9099175 GATGGAAAGGGAAAGGCGCATGG + Intergenic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901646713 1:10720805-10720827 GAGGGTGAGTGGAAGCTGGAGGG + Intronic
901756193 1:11443006-11443028 GAGAAAAAGGGAGAGGTGGAGGG + Intergenic
901771357 1:11531940-11531962 GAGGGAAGGGGAAAGGTGGGTGG - Intronic
901863623 1:12090017-12090039 GATGGATGGGGAAAGGTGGATGG - Intronic
901863650 1:12090126-12090148 GATGGATGGGGAAAGGTGGATGG - Intronic
901863674 1:12090223-12090245 GATGGATGGGGAAAGGTGGATGG - Intronic
901863695 1:12090308-12090330 GATGGATGGGGAAAGGTGGATGG - Intronic
901930600 1:12594547-12594569 GATGGTGGGGGAAAGGTGCAGGG + Intronic
902078534 1:13805616-13805638 GAAGGTAGGGGAAAGGCAGAGGG - Intronic
902525266 1:17053432-17053454 CAGGGGAAGGGAGAGATGGAGGG - Intronic
902551703 1:17223367-17223389 GAGGGTGGGGGAAAGGTGGAGGG - Intronic
902754430 1:18539960-18539982 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
902805088 1:18855981-18856003 GACTATAGGGGAAAGGTGGATGG - Intronic
903410765 1:23141203-23141225 GAAGGTGGGGGAAAGGAGGAAGG + Intronic
903416919 1:23189906-23189928 GAAGGAAAGGGAAAGGCGGGAGG - Intergenic
903576048 1:24340582-24340604 GAGGGGAAGGGACAGGCCGAAGG - Intronic
903660621 1:24975211-24975233 GAGGGAAAGGGAAAGGGAAAGGG + Intergenic
903787548 1:25871527-25871549 GAGGGGAGGGGAAGGGAGGAAGG - Intergenic
904193995 1:28770932-28770954 GAAGGGAAGGGAAGGGGGGAAGG - Intergenic
904406724 1:30295843-30295865 GAGGATAAGGGACAGGTGTGTGG - Intergenic
904440130 1:30524611-30524633 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
904560981 1:31397257-31397279 GAGGTGAGGGGAAGGGTGGATGG + Intergenic
904989417 1:34579611-34579633 TAGGGGTAGGGAAATGTGGAGGG - Intergenic
905076893 1:35280171-35280193 GAAGGGAAGGGAAGGGGGGAAGG - Intronic
905199375 1:36306125-36306147 GAGGGAAAGGGAGAGGCGGCTGG + Intergenic
905207771 1:36352738-36352760 GAGGGCAAGGGACATGTGGAGGG - Intronic
905800883 1:40841808-40841830 GAGGGCAAAGGAAACATGGAAGG - Intergenic
905898154 1:41562515-41562537 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
906199350 1:43949090-43949112 GAGGGCAAGGCCCAGGTGGAAGG - Intronic
906201974 1:43966277-43966299 GAGGGGGAGGGAAAGGTGTCTGG + Intronic
906500882 1:46341258-46341280 ATGGGCAAGGGAAAGGGGGAGGG - Intronic
906509096 1:46400923-46400945 GAAGGGAAGGGAAGGGTAGAGGG + Intronic
906617639 1:47245089-47245111 GTGCGTAGAGGAAAGGTGGAGGG + Intergenic
906647609 1:47487030-47487052 GAGGGAAAGAGAAGGGGGGATGG - Intergenic
906821308 1:48933345-48933367 GAGTTTAAGGCAAAGTTGGATGG - Intronic
906925345 1:50109961-50109983 GATGGTAAGTGAAAAGAGGAAGG + Intronic
906954940 1:50366434-50366456 GAAGGGAAGGGAAAGAAGGAAGG - Intergenic
906956611 1:50380843-50380865 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907184486 1:52599506-52599528 GAGTGAAAGGGACAGGTGGCAGG + Intergenic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
908692583 1:66799439-66799461 GAGGGTGAGGGTGAGGGGGATGG + Intronic
908728870 1:67206000-67206022 GAAAGGAAGGGAAAGGAGGAAGG - Intronic
909278411 1:73718522-73718544 GAAAGTAAGGGAGTGGTGGATGG - Intergenic
909286538 1:73826960-73826982 GAGGGAAAAGGAATGGGGGAGGG + Intergenic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
909606298 1:77511918-77511940 GAGGTCAAGGGAAAAGTGAAAGG + Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910292617 1:85614190-85614212 GAGTGAAAAGGCAAGGTGGAGGG - Intergenic
910343595 1:86215102-86215124 GAGGGGGAGGGAGAGGGGGAGGG - Intergenic
910343601 1:86215114-86215136 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
910601753 1:89040172-89040194 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
910992457 1:93070245-93070267 GAGGGTAAGAGACAGGGGAACGG - Intergenic
911326039 1:96470627-96470649 GAGGGAGAGGGAAAGGGAGAGGG + Intergenic
911326041 1:96470633-96470655 GAGGGAAAGGGAGAGGGAGAGGG + Intergenic
911542293 1:99172385-99172407 GAGGGTAAGGGGTGGGAGGAGGG - Intergenic
911569610 1:99507582-99507604 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
911620893 1:100065618-100065640 AAGGGAAAGGGAAAAGGGGAGGG - Intronic
911746091 1:101443178-101443200 GAGGGTAGGGGGCAGGGGGATGG + Intergenic
911764387 1:101656594-101656616 GAAGGGATGGGAAAGGTGAATGG + Intergenic
911798704 1:102107374-102107396 GAGGGTGAGTGAAAGTTAGAAGG + Intergenic
911803311 1:102173477-102173499 GAGAGGAAGGGAGAGGGGGAAGG - Intergenic
912088502 1:106040337-106040359 GATGGAAAGGGAAAGGAAGAAGG + Intergenic
912227825 1:107755388-107755410 GGGGGTGAGGGGAAGCTGGATGG + Intronic
912283611 1:108344464-108344486 GAGGGTAGGAGGAGGGTGGAGGG + Intergenic
912316800 1:108675051-108675073 GAGGGAGAGGGAGAGGTAGAGGG - Intergenic
912331218 1:108821825-108821847 GAGGGAAAGGGAAGGGGAGAAGG - Intronic
912509522 1:110179505-110179527 AAGGGGAAGGGAAAGGAAGAAGG - Intronic
912541544 1:110420036-110420058 GAGGCTCAAGGAAGGGTGGAGGG + Intergenic
912710971 1:111949507-111949529 AAGGGTAAGGAAAAGGTGAGGGG + Intronic
912727949 1:112075944-112075966 GTGGGTAAGGGATGGGTGGATGG + Intergenic
912798386 1:112706548-112706570 GAGGATAAGGGAGATGGGGAAGG - Intronic
913055985 1:115160024-115160046 GAGGGAAAGGGAGAGGGAGATGG + Intergenic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913397312 1:118386216-118386238 GGGGTTTAGGGAAAGGTGGCTGG + Intergenic
913528934 1:119719327-119719349 GAGGGGAAGGGAAAGTAGGCAGG + Intronic
913582894 1:120244781-120244803 GAGGCGAAAGGAAGGGTGGACGG - Intergenic
913625278 1:120653579-120653601 GAGGTGAAAGGAAGGGTGGACGG + Intergenic
913705533 1:121418565-121418587 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
914258669 1:145980890-145980912 GAAAGTAGGGGAAAGGTTGATGG - Intergenic
914374428 1:147061240-147061262 GAGGGTGAGGGAGAGGGAGAGGG - Intergenic
914513431 1:148353912-148353934 GAGGAAAAGGGAGAGGAGGAGGG - Intergenic
914564825 1:148856277-148856299 GAGGCGAAAGGAAGGGTGGACGG - Intronic
914608001 1:149273965-149273987 GAGGCGAAAGGAAGGGTGGACGG + Intergenic
914665887 1:149832341-149832363 GAGGCTAAGGGAAAGGTCTCTGG - Intergenic
914669878 1:149861453-149861475 GAGGCTAAGGGAAAGGTCTCTGG + Intronic
914958334 1:152184590-152184612 GAGAGAGAGAGAAAGGTGGAGGG + Intergenic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915449728 1:155996263-155996285 GAGGCTAAGGGAAAATGGGAGGG - Intronic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
915737306 1:158093311-158093333 GATGGGGAAGGAAAGGTGGAGGG - Intronic
915745566 1:158154355-158154377 GAGGGTGAGGGAGAGGTAGAAGG + Intergenic
915878797 1:159643419-159643441 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
915979174 1:160409453-160409475 AAGGGAAAGGGAAAGGGGAAGGG + Intronic
916003034 1:160634719-160634741 GAGGGTGAGGGACAGGAGGTGGG + Exonic
916030102 1:160869156-160869178 GAAGGTGAGAGAGAGGTGGACGG + Intergenic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916415459 1:164588612-164588634 GAGAGCAAGGGAAAGGAAGAAGG - Intronic
916426955 1:164689838-164689860 GAGGGGGAGGGATAGGTGTAGGG - Intronic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916620684 1:166493142-166493164 GAGGGTAGAGGATAGGAGGAGGG + Intergenic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
917124715 1:171676909-171676931 GAAGGTGATGGAAAGGGGGAAGG + Intergenic
917139061 1:171816529-171816551 GAGGGGAAGGGAAGGGAGTAGGG - Intergenic
917211902 1:172640310-172640332 GCGGGCAAGGGAATGGTGCAAGG - Intergenic
917621686 1:176802484-176802506 GAGTGTCAGGGACAGATGGAGGG + Intronic
917762612 1:178179495-178179517 GAGGGTAAGAGAAAGGAGAGAGG + Intronic
917889318 1:179419633-179419655 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
917954900 1:180085103-180085125 AAGGGAAAGGGAAAGGGGAAAGG - Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918646508 1:186912036-186912058 GAGGAGAACAGAAAGGTGGAAGG - Intronic
918677405 1:187304689-187304711 GAGGGTAAAGGATGGGAGGAGGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919056613 1:192578615-192578637 GAGGGTGAGGGAAGGGTTAAGGG + Intronic
919710312 1:200720994-200721016 GAGGGGAAGGGAAGGGAGGAAGG - Intergenic
919773953 1:201181579-201181601 GAGAGTAAGGGATGGATGGAAGG - Intergenic
919918407 1:202153422-202153444 GAGGTTAAAGGAGATGTGGAAGG - Intronic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920330237 1:205202089-205202111 AAGGGGAAGGGAGAGGGGGAAGG + Intronic
920441111 1:205980865-205980887 GAGGTGAAGGGGAAGGGGGAGGG - Intronic
920498419 1:206471282-206471304 GAGGGGAGGGGAGAGGTGGGTGG + Intronic
920588537 1:207193815-207193837 GAGGGTGAAGGATAGGAGGAGGG - Intergenic
920733825 1:208513104-208513126 GGGGGAAAGGGACAGGTGCATGG + Intergenic
920910962 1:210216197-210216219 GAGGGTAAGGTGAAGTGGGATGG + Intergenic
921192599 1:212724193-212724215 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
921232186 1:213084130-213084152 GAGGGAAAGGGAGAGAGGGAAGG - Intronic
921285028 1:213601893-213601915 GAAGGGAAGGGAAAGAGGGAAGG - Intergenic
921562725 1:216677591-216677613 AAGGGAAAGGGAAAGGTAAAAGG + Intronic
921853479 1:219955177-219955199 GGGAGTAGGGGAAAGGTTGAAGG - Intronic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922090327 1:222389608-222389630 GAGGGTTAGGGGGAGGTGGGTGG - Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922247731 1:223817205-223817227 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247744 1:223817241-223817263 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247752 1:223817259-223817281 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247760 1:223817277-223817299 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247768 1:223817295-223817317 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247776 1:223817313-223817335 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247784 1:223817331-223817353 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247792 1:223817349-223817371 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247800 1:223817367-223817389 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922424115 1:225478135-225478157 GAGGTTCAGTGACAGGTGGAGGG + Intergenic
922504020 1:226115948-226115970 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
922936405 1:229426357-229426379 GAGGGAAAGGGAAATTTTGAAGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923136910 1:231127827-231127849 GAGGGTGAGGGAGAGGGAGAGGG - Intergenic
923215654 1:231845735-231845757 GAGGGAAAGTGATAGGTTGAGGG + Intronic
923589043 1:235302215-235302237 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
923636590 1:235703901-235703923 TAGGGTGAGGGATAGGAGGAGGG - Intronic
924927479 1:248696911-248696933 GAGGATTAGGGAAGGGTGAATGG + Intergenic
1062818372 10:516722-516744 GAAGGGAGGGGAAAGGGGGAGGG + Intronic
1062826332 10:571491-571513 GAAGGGAAGTGAAAGGGGGAGGG - Intronic
1063101320 10:2952661-2952683 GAAAGTAAGAGAAAGGTGGGAGG + Intergenic
1063157337 10:3391712-3391734 GAAGGGAAGGGAAAGGAGAAAGG + Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063484308 10:6404920-6404942 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1063511211 10:6646919-6646941 GAGGGAAAGGGAAAGGGGGAGGG - Intergenic
1063511242 10:6647047-6647069 GAGGGAAAGGGAAAGGGGCAGGG - Intergenic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063870060 10:10407686-10407708 GAAGGTAAGTGCAAGCTGGAAGG - Intergenic
1064188702 10:13186450-13186472 GAGGGCAGGGGAAAGGTGAGGGG + Intronic
1064587396 10:16852267-16852289 GTGAGGAAGGGAAAGATGGAGGG - Intronic
1064763223 10:18643674-18643696 GAGGGAAAGAGAAAGGAAGAAGG - Intronic
1065202898 10:23331212-23331234 GAAGGGAAGGGAAGGGAGGAGGG + Intronic
1065540847 10:26765623-26765645 GAGGGGAAGGGAAGGAGGGAGGG + Intronic
1065932147 10:30489519-30489541 GAGGGCAAGGGAAATTTTGAAGG - Intergenic
1066115403 10:32234274-32234296 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1066334611 10:34463142-34463164 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1067067732 10:43113126-43113148 CAGGGTCAGGGACAGGGGGAAGG + Intronic
1067112393 10:43409368-43409390 GAGGGGAGGGGATAGGGGGAGGG + Intergenic
1067685455 10:48464071-48464093 AGGGGTTATGGAAAGGTGGATGG - Intronic
1067832305 10:49617177-49617199 GGGGGAAAGGGGAAGGGGGAAGG - Intronic
1068444297 10:57101144-57101166 GAGGGTAAGGGGTAAGAGGAAGG - Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068724829 10:60289382-60289404 GAGAGAAAGAGAAAGGGGGAGGG - Intronic
1068841690 10:61621773-61621795 GAGGGTAAGGGCAGGGCAGAGGG + Intergenic
1069494793 10:68893833-68893855 GAGGTTTAGAGAAAGGTGGAAGG + Intronic
1069591711 10:69645987-69646009 AAGGGAGAGGGAGAGGTGGAGGG + Intergenic
1069872157 10:71539861-71539883 GAGGGAAAGGGGAAGATGGGTGG - Intronic
1070561073 10:77566929-77566951 GAGGGGAAGGGAAGGAAGGAGGG + Intronic
1070732508 10:78841102-78841124 GAGGCTGAGGGAAAAGGGGAGGG + Intergenic
1070932407 10:80270718-80270740 CAGTGTTAGGGAAATGTGGACGG - Intergenic
1071366829 10:84908400-84908422 AAGGGAAAGGGAAAGATGGCAGG + Intergenic
1071616279 10:87079910-87079932 GAGGGGGAGGGAGAGGGGGAGGG - Intronic
1071616285 10:87079922-87079944 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
1071794285 10:88988981-88989003 GAGGGTAGGGGAAGGGGGTATGG + Intronic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1072001625 10:91200929-91200951 GAGGGAAGTGGAAAGGGGGAGGG + Intronic
1072718562 10:97767228-97767250 GAGGGTAAGGGAAAGGTGGAGGG - Exonic
1073245637 10:102088231-102088253 TGGGGTAAGGGACAAGTGGAGGG - Intergenic
1073592105 10:104767552-104767574 GAGAGGAAGGGAAAGGGGGAAGG - Intronic
1074152323 10:110768241-110768263 GAGGGAAAGGGAGAGGGAGAGGG + Intronic
1074345461 10:112681182-112681204 GAGGCTAAGGTGGAGGTGGAAGG - Intronic
1074885800 10:117692326-117692348 GAGGGTGATGGATAGGAGGAGGG - Intergenic
1075013133 10:118891808-118891830 AAGGGAAAGGGAAAGGGGAAGGG + Intergenic
1075108731 10:119560506-119560528 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
1075122677 10:119675820-119675842 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1075183510 10:120233492-120233514 GGAGGTGAGGGAGAGGTGGAAGG + Intergenic
1075273445 10:121073174-121073196 GAGGCAAAAGGAAAGGAGGAAGG + Intergenic
1075968173 10:126630805-126630827 GATGGTAAGGGAATGGAGGGTGG - Intronic
1076039776 10:127236323-127236345 GAGGGGAGGGGAGAGGGGGAGGG - Intronic
1076102963 10:127797606-127797628 GAGGGTGAGGGATGGATGGAGGG - Intergenic
1076229100 10:128805175-128805197 GAGGAGCAAGGAAAGGTGGAAGG - Intergenic
1076305550 10:129463472-129463494 GAGGGTAAGGGAATGGTGCAGGG - Intergenic
1076486453 10:130822159-130822181 GAGAGGAAGGGAAAGAGGGAGGG + Intergenic
1076666840 10:132097984-132098006 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076869336 10:133185844-133185866 GAGGGGAGGGGAGAGGTGGGAGG + Intronic
1076994758 11:292473-292495 GAGGGCACGGGAAAGTTGGGGGG + Intronic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1077632088 11:3817632-3817654 GAGGGAAAGGGACAAGGGGATGG + Intronic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077779267 11:5307655-5307677 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1078043714 11:7893567-7893589 GAGGGTAGGAGAAAGGTGTCAGG - Intergenic
1078082040 11:8211226-8211248 GAGGAGCAGAGAAAGGTGGATGG + Intergenic
1078122231 11:8522750-8522772 GAGGGAAAGGGAGAGGGAGAGGG - Intronic
1078655917 11:13239023-13239045 GTGGGTAAGGGTTTGGTGGAGGG - Intergenic
1078807959 11:14725515-14725537 GAGGGGAAGGGAAGGGGAGAAGG - Intronic
1079107254 11:17579433-17579455 GAGGCCAGGGGAAGGGTGGAGGG + Intronic
1079143514 11:17830618-17830640 GAGAGAGAGGGAAAGGGGGAGGG + Intronic
1079150712 11:17896677-17896699 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1079206142 11:18416683-18416705 GAAGGGAAGGGGAAGATGGAAGG - Intronic
1079360311 11:19765445-19765467 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1079390034 11:20014202-20014224 GAGGGAGAGGGACAGGTGGCTGG - Intronic
1079492713 11:21007178-21007200 GAGGATAAGGGAAAGATGTGAGG - Intronic
1079632393 11:22694012-22694034 GAGGGTAGCGGGAAGGAGGAGGG + Intronic
1079676546 11:23234674-23234696 GAGGGAAATGGAATGGTGAAAGG - Intergenic
1080202473 11:29688807-29688829 GAGGGAAAGGGAAAGGGGAAGGG + Intergenic
1080538200 11:33243022-33243044 GAGGGGGAGGGAGAGGGGGAGGG - Intergenic
1080538206 11:33243034-33243056 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1080832666 11:35910609-35910631 GAGGGGTAGTGAAAGGTGGGGGG - Intergenic
1080862718 11:36163737-36163759 GAGAGAAAGGGAAAAGGGGAGGG + Intronic
1081108731 11:39105291-39105313 GAGGTTAGGGGAAAGGGGCATGG + Intergenic
1082244395 11:49904953-49904975 GAAGGAAAGGGAAAGGGGAAGGG + Intergenic
1082848335 11:57743982-57744004 GAGGCTTAGGGAAGGGAGGAAGG + Exonic
1083024389 11:59537646-59537668 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1083141844 11:60728696-60728718 GAGGGAAAGGAAAAGGGGGAAGG - Intergenic
1083162785 11:60865590-60865612 GAGGGTAAGAGGAAGGAGAAGGG - Intergenic
1083271026 11:61572689-61572711 GAAGGTCAGGGAAAGCTGCAAGG - Intronic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083382101 11:62277878-62277900 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1083414013 11:62513597-62513619 GAGGGCAGGGGTAAGGTGCATGG + Intronic
1083537941 11:63489310-63489332 GATGAAAAGGGAAAGGAGGAAGG - Intronic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083913069 11:65721062-65721084 GAAGGGAAGGGAAGGGGGGAAGG - Intergenic
1084203387 11:67577000-67577022 GAGGGGAGGGGCAAGGTGGGTGG + Intergenic
1084441814 11:69178957-69178979 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1084569943 11:69953296-69953318 TAGGGTGAGGGAAATGTGGATGG + Intergenic
1084735195 11:71100905-71100927 GAGGGCAAGGGAGGGATGGACGG + Intronic
1084785720 11:71440617-71440639 GTGGGTGATGGATAGGTGGATGG + Intronic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084839082 11:71830828-71830850 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1085027719 11:73246708-73246730 TAGGCTGAGGAAAAGGTGGAAGG - Intergenic
1085112240 11:73898200-73898222 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1085639028 11:78179658-78179680 GAGGGAAAGAGGAAGGTGGTTGG - Intronic
1085832369 11:79915237-79915259 GGGGGTAAAGGAAAATTGGAGGG + Intergenic
1086008805 11:82073251-82073273 GAAAGTAAGGCAAAGGTGGAGGG - Intergenic
1086077437 11:82869455-82869477 GAAGGGAAGGGAAAGGAGGAAGG + Intronic
1086436287 11:86784199-86784221 GAAGGCAGGGGACAGGTGGACGG - Intergenic
1086472041 11:87124357-87124379 GAGGTTAAAGGCAAGGTGGAAGG - Intronic
1086582214 11:88412251-88412273 GAGGGTGAGGGACAAGGGGAGGG - Intergenic
1087068517 11:94050806-94050828 AAGGGTAGTGGAAAGGTGGGAGG - Intronic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1088108129 11:106228547-106228569 GATGGTAATGGAAATGAGGATGG - Intergenic
1088171273 11:106999937-106999959 GCGGGTGAGGGAAAAATGGAAGG - Intronic
1088512496 11:110592590-110592612 GAGGGAAAGATAAAGGTGGAAGG + Intronic
1088524302 11:110736293-110736315 GAGAGAAAGGGAAAGAAGGAAGG + Intergenic
1088645629 11:111913985-111914007 TGGGGGAAGGGAAAGGTGCATGG + Exonic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088884002 11:113993040-113993062 GAGGGAAGTGGAAGGGTGGAGGG + Intergenic
1089057651 11:115599445-115599467 GAGGGAAAGGGAAAGGGAAAGGG - Intergenic
1089161325 11:116439740-116439762 GTGGGTGAGGCCAAGGTGGATGG + Intergenic
1089181447 11:116585924-116585946 GAGGGGAAGGCAAAGGAGAAAGG - Intergenic
1089300705 11:117497162-117497184 GAGGGAAAGGGACAGGAGGATGG + Intronic
1089421301 11:118332745-118332767 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1089813028 11:121147384-121147406 GATTGTAAGGGAAGGGTGGGAGG + Intronic
1089876796 11:121730209-121730231 GAGGGTAAGGAAGAGAAGGAGGG - Intergenic
1090083906 11:123634079-123634101 GAGGGGAAGGCAGATGTGGATGG - Intronic
1090235253 11:125142218-125142240 GAGAGCAAGGGAAAGGGAGAAGG - Intergenic
1090601872 11:128380645-128380667 GAGGGGAAGGGGAAGAGGGAAGG - Intergenic
1090703229 11:129314795-129314817 GAGGGAGAGGGGAAGGGGGAAGG - Intergenic
1091155527 11:133368185-133368207 GGGGGAGAGGGAAAGGTAGAAGG + Intronic
1091184905 11:133638374-133638396 GAAGGGAAGGGGAAGGTGGTGGG - Intergenic
1091192472 11:133706986-133707008 AAGGGAAAGGGAAAGGGGAAAGG + Intergenic
1091209171 11:133842118-133842140 GAGGAGAAGGGCCAGGTGGAGGG + Intronic
1091253405 11:134163093-134163115 GGAGGTATGGGAAAGGTGGAAGG + Intronic
1091297233 11:134482392-134482414 GAGGGTGAGGGAAAGAAGGTGGG + Intergenic
1091531383 12:1359530-1359552 GAGGGTAAGAGAAAGGCGGAAGG + Intronic
1091618878 12:2070931-2070953 GAGGGAAGGGGAAAGGGGAAAGG - Intronic
1091726195 12:2848315-2848337 GAGGGTGATGGGAAGGTGGCTGG - Intronic
1092227115 12:6754588-6754610 GAGGATAAGGGGAAGTTGCATGG - Intronic
1092262743 12:6961222-6961244 CAGGGTCAGGGAGAGGTGGGGGG - Exonic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1092453357 12:8624331-8624353 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1092817240 12:12322940-12322962 GAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1093017644 12:14170961-14170983 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093038340 12:14354049-14354071 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1093408436 12:18835044-18835066 GAGGGTGAGGGATGGGTGGAGGG + Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1093967936 12:25346734-25346756 GAGGGGAAGGGAAGGGTAAAGGG - Intergenic
1094209231 12:27873304-27873326 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1094380758 12:29840663-29840685 AAGGGGAAGGGAAAAGTGAAGGG - Intergenic
1094817867 12:34204834-34204856 GAGAGCAAGGGAAAGAGGGATGG - Intergenic
1094839931 12:34338618-34338640 GAGGTCAAGGCAACGGTGGAAGG + Intergenic
1094841731 12:34345178-34345200 GAGGCCAAGGCACAGGTGGAAGG - Intergenic
1095099020 12:38162437-38162459 GAGAGCAAGGGAAAGAGGGATGG + Intergenic
1095403822 12:41845213-41845235 GAGGGAAGGGGAAAGGAGTATGG + Intergenic
1095646209 12:44550858-44550880 GAGGTTAAGGGGAAAGGGGAAGG + Intronic
1095985549 12:47997303-47997325 GGGTGTAAGGGATAGGAGGAAGG - Intronic
1096231594 12:49899939-49899961 GAGGATATGGGAAATGAGGAAGG + Intronic
1096318927 12:50593780-50593802 GAGGGGAAGGGAGAGGGGGGGGG - Intronic
1096580768 12:52583290-52583312 TGGGCTAAGTGAAAGGTGGAGGG - Intergenic
1096977739 12:55708881-55708903 GAGGGAAAGGGAGAGGAAGAGGG - Intronic
1096981559 12:55730449-55730471 GAGGGAAAGGGAGAGGAGAATGG + Intergenic
1097285077 12:57870904-57870926 GAGGGAGAAGGAAAGGGGGAAGG - Intergenic
1097779384 12:63686134-63686156 GAGGGAAAGGGAGAGGGAGAGGG - Intergenic
1097980629 12:65734482-65734504 GAGGGTCAGGGAGAGGGGCAAGG + Intergenic
1098183836 12:67876220-67876242 AAGGGAAAGGGAAAGGTAGAGGG + Intergenic
1098288693 12:68934104-68934126 GAGGGAAGGGGAGAGGGGGAGGG - Intronic
1098739480 12:74154172-74154194 AAGGGGATGGGAGAGGTGGAGGG + Intergenic
1098774053 12:74588933-74588955 GAGGGAGAGGGAGAGGGGGACGG + Intergenic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1099466718 12:82997181-82997203 GAGGGGGAGGGAGAGGGGGAGGG - Intronic
1100121089 12:91370252-91370274 GAGCCTAAGGGAAAAGAGGAAGG + Intergenic
1100239106 12:92692694-92692716 GTGGGGAAGGGAAAAATGGAAGG + Intergenic
1100256334 12:92886626-92886648 GAGGGGAGGGGGAAGGGGGAAGG + Intronic
1100272895 12:93043473-93043495 GAGGGTGGGGGAAGGGAGGAAGG - Intergenic
1100556158 12:95695987-95696009 GAGGGAAAGGGGAAGGGGAAGGG - Intronic
1100777607 12:97989643-97989665 GAAGGGAAGGGAAAGGGGAAGGG + Intergenic
1101209713 12:102523831-102523853 GAGGGAGAGGGAGAGGGGGAAGG + Intergenic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1101831882 12:108264136-108264158 GGAGGTGAGGGAAGGGTGGATGG - Intergenic
1101892750 12:108731304-108731326 GAGGGGCAGGGCTAGGTGGAGGG - Intronic
1102001553 12:109560955-109560977 GAGGGAGAGGGAGAGGAGGACGG - Intronic
1102167867 12:110820774-110820796 GAGGGGGAGGGACAGGGGGAGGG - Intergenic
1102175188 12:110868731-110868753 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
1102175195 12:110868743-110868765 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102229098 12:111250132-111250154 GAGTGGAAGGGAAAGGGGGTGGG - Intronic
1102554607 12:113718890-113718912 TAGGGAGAGGGAAAGCTGGAAGG - Intergenic
1102753880 12:115320991-115321013 GTGGGGAAGGCAAAGGTGGGAGG + Intergenic
1102789837 12:115635913-115635935 GAAGGGAAGGGAAAGGGGGAGGG + Intergenic
1102879875 12:116476143-116476165 GTGTGTAAGGTAAAAGTGGATGG + Intergenic
1102984096 12:117264699-117264721 GAGGGAAAGGGAGAGGGAGAGGG - Intronic
1103011804 12:117463771-117463793 GTGGGGATGGGAATGGTGGAAGG + Exonic
1103018332 12:117513518-117513540 GAGGGAAAGGGACAAGTGGCAGG + Intronic
1103735390 12:123057778-123057800 GAGGCTATGGGAAAGAAGGAGGG + Intronic
1104134532 12:125924362-125924384 GAAGGAAAGGGAAAGAAGGAAGG - Intergenic
1104254090 12:127124036-127124058 GAGGGTAGGGGATAGAGGGAGGG + Intergenic
1104254504 12:127125046-127125068 GAGGGTAGGGGATAGAGGGAGGG + Intergenic
1104714397 12:131006692-131006714 GAGGATGAGGGAAATGAGGAGGG + Intronic
1104836629 12:131795983-131796005 GAGGGGAGGGGAGAGGGGGAGGG + Intronic
1104836642 12:131796006-131796028 GAGGGGAGGGGAGAGGGGGAGGG + Intronic
1106227226 13:27794480-27794502 GAGGGGAAGGGAAAAGGAGAAGG - Exonic
1106379600 13:29223606-29223628 GAGGCTCATGGAGAGGTGGAGGG - Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107042681 13:35966506-35966528 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
1107337378 13:39369618-39369640 GAGAGGAAAGGAAAGGGGGAAGG - Intronic
1107375185 13:39796644-39796666 GAGAGGAAGGGAAGGGAGGAAGG + Intergenic
1107376277 13:39808258-39808280 GAAGGAAAGGGAAAAGGGGAAGG - Intergenic
1107656829 13:42600001-42600023 TAGGGCAAGAGTAAGGTGGAGGG - Intronic
1107761196 13:43681091-43681113 GAGGAGAAGGGAAAGGGGCAGGG - Intronic
1107819910 13:44277181-44277203 AAGGGGAAGGGAAAGAGGGAGGG + Intergenic
1107863725 13:44683474-44683496 GAGGGGGAGGGAGAGGGGGAGGG + Intergenic
1108275381 13:48804119-48804141 AAGGACAAGGGACAGGTGGATGG - Intergenic
1108324047 13:49312918-49312940 GGTGGGAGGGGAAAGGTGGAAGG - Intronic
1108346417 13:49551112-49551134 GAAGGGAAGGGAAGGGGGGAGGG + Intronic
1108357727 13:49642442-49642464 GAGGGAAAGAGAAAGAGGGAAGG + Intergenic
1108676788 13:52743917-52743939 AAGGGTGTGGGAAATGTGGAGGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109815070 13:67570865-67570887 AAGGGTCAGGGAATGGTGAATGG - Intergenic
1109833789 13:67828388-67828410 TAGGTTAAGGGACAGGTGTAGGG + Intergenic
1109895083 13:68676733-68676755 GAGGGGAAGGGAGGGGGGGAGGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110369831 13:74727495-74727517 GAGGGGAGGGGAAAGGAGGGAGG + Intergenic
1110537587 13:76669690-76669712 GAGGGTAGGGGAAAGAGGAAGGG - Intergenic
1110618845 13:77572186-77572208 GACGGTAAGGGAAAGGTGTCAGG + Exonic
1111313685 13:86522740-86522762 GAGGGTGAAGGATAGGAGGAGGG + Intergenic
1112015171 13:95325564-95325586 AGGGGAAAGGGAAAGGGGGAAGG + Intergenic
1112172005 13:96983412-96983434 GAAGGGAAGGGAAAGGGGGAAGG + Intergenic
1113541759 13:111115117-111115139 GCGGGGAAGGGAAAGGGGAAGGG - Intronic
1113975589 13:114225459-114225481 GAGGGGGAGGGAAAGGGGGAGGG + Intergenic
1113975604 13:114225486-114225508 GAGGGGGAGGGAAAGGGGGAGGG + Intergenic
1113975619 13:114225513-114225535 GAGGGGGAGGGAAAGGGGGAGGG + Intergenic
1113975633 13:114225540-114225562 GAGGGGGAGGGAAAGGGGGAGGG + Intergenic
1114245116 14:20905581-20905603 AAGAGTAAGGGAAGAGTGGAAGG + Intergenic
1114376207 14:22149060-22149082 GAGGGGGTGAGAAAGGTGGAAGG - Intergenic
1114543801 14:23483510-23483532 GAGGGCTGGGGAAAGGGGGAGGG - Intronic
1114770257 14:25422679-25422701 GTTGGAAAGTGAAAGGTGGAAGG - Intergenic
1114791096 14:25659425-25659447 GAGGGAATGGCAAAGGAGGAGGG - Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115196422 14:30805238-30805260 GAGGGTAAGGGAAAGGATTTAGG + Intergenic
1115259643 14:31438210-31438232 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
1115507171 14:34103790-34103812 GAAGGTCAGGGATAGGTGGCTGG + Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1115724158 14:36194679-36194701 GAGGGGAGGGGAGAGGGGGAGGG + Intergenic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1116385873 14:44328974-44328996 GAGAGTAATGGAAAGAGGGAGGG - Intergenic
1116501940 14:45634477-45634499 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1116640754 14:47459459-47459481 AAGGGAAAGGAAAAGATGGAAGG - Intronic
1116707973 14:48327719-48327741 GGGGGTAAGGGGAGGGGGGAGGG - Intergenic
1116974137 14:51096296-51096318 GGGGGGAAAGGAAAGGCGGAAGG + Intergenic
1117000285 14:51364939-51364961 GAGGGTCAGCAAAAGGTGGTGGG + Intergenic
1117008783 14:51449223-51449245 GAGGGAAAGGGATAGTGGGAAGG + Intergenic
1117010804 14:51468309-51468331 GAGGGGGAGGGAGAGGGGGAGGG + Intergenic
1117307362 14:54489474-54489496 GAGAGAGAGGGAAAGGGGGAGGG - Intergenic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1117715009 14:58571629-58571651 AAGGGGGAGGGAAAGGTGCAAGG - Intergenic
1117794518 14:59378240-59378262 TTGGGAAGGGGAAAGGTGGAAGG + Intergenic
1118466937 14:66039534-66039556 AAAGGTAAGTGAAAGGTAGATGG - Intergenic
1118706225 14:68483014-68483036 TAGGGGAAGGGAAAGGTGGATGG + Intronic
1118743659 14:68758887-68758909 GAGGGGAAGGGTCAGGGGGAGGG - Intergenic
1118860068 14:69656091-69656113 GAAGGGAAAGGAAAGGAGGAAGG - Intronic
1118874210 14:69768893-69768915 GACGGTATGTGAAGGGTGGATGG + Exonic
1119124219 14:72110550-72110572 GAGGGGAATGGAAAGGAAGAAGG - Intronic
1119281158 14:73409290-73409312 GAGAGGAAGGCAAAGGTGCATGG - Intronic
1119319739 14:73722924-73722946 GAAGTTAAGGGAAAGATGCAGGG - Intronic
1119615828 14:76098709-76098731 GAGGGAGAGAGAAAGGGGGAGGG - Intergenic
1119761612 14:77155630-77155652 GAGAGAAAGGGAAAGGGGAAGGG + Intronic
1119852315 14:77874901-77874923 ATGGTTAAGGGACAGGTGGATGG + Intronic
1119862833 14:77948884-77948906 GAGGGGTAGGGGAAGGGGGAGGG - Intergenic
1119922199 14:78456932-78456954 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1120396372 14:83971858-83971880 GAGGGAAATGGACAAGTGGAGGG + Intergenic
1120420883 14:84284323-84284345 GAGGGGATGGGAAGGGGGGAGGG + Intergenic
1120899906 14:89566864-89566886 GAGGGTAAGGAAGAGGAGGGGGG - Intronic
1121593363 14:95137488-95137510 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1121593388 14:95137561-95137583 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1121898911 14:97674465-97674487 GAGGGTGAGCCAAAGGTGGGTGG + Intergenic
1121928710 14:97952522-97952544 GAGGGAAAGGGGAAAGGGGAGGG - Intronic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1124607712 15:31183944-31183966 GAGGGGGAGGGAGAGGAGGAGGG - Intergenic
1124612235 15:31216219-31216241 GAGGGGAAGGGGGAGGCGGAGGG + Intergenic
1124647678 15:31450450-31450472 GAAGGGGAGGGAGAGGTGGAAGG + Intergenic
1124716151 15:32064243-32064265 AAGGGGAAGGGAAAGGGGCACGG - Intronic
1125616473 15:41018502-41018524 GTGGGGAAGGGAGAAGTGGATGG + Intronic
1125697537 15:41651764-41651786 GAGGGGAAAGGAGAGGGGGAGGG - Intronic
1125697553 15:41651803-41651825 GAGGAGAAGGGAAAGGAAGAGGG - Intronic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126151358 15:45526216-45526238 GAAGGAAGGGGAAAGGAGGAGGG - Intergenic
1126295189 15:47131724-47131746 GAGGGAGAGGGACAGGGGGAGGG - Intergenic
1126370682 15:47943393-47943415 GAGGAAAAAGGAAAGGAGGAAGG + Intergenic
1127136531 15:55929477-55929499 GAGGGTAGAGGAGAGGAGGAGGG - Intronic
1127230266 15:56984302-56984324 GAGAGGGAGAGAAAGGTGGATGG + Intronic
1127267562 15:57374221-57374243 GAAGGTAAGGAAAAGGGGAAGGG - Intergenic
1127446391 15:59067343-59067365 AAGGGGAAGGGAAAGGAGAAAGG - Intronic
1127470152 15:59282955-59282977 GAGGGGAGGGGAAAGGGGAAAGG + Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127783162 15:62333341-62333363 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1127824527 15:62691032-62691054 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
1127863735 15:63014842-63014864 AGGGGTCAGGGAAAGGGGGATGG + Intergenic
1128082051 15:64862479-64862501 GAGGGTATGGGCAATGGGGAGGG + Intronic
1128210365 15:65895671-65895693 GAGGAGAAGGGAAAGGCAGAGGG - Exonic
1128498238 15:68210364-68210386 GAAGGTTGGGGAAGGGTGGAGGG - Intronic
1128796924 15:70472834-70472856 GGAGGGAGGGGAAAGGTGGATGG + Intergenic
1128817356 15:70621700-70621722 TGGGGTGAGGGAAGGGTGGAGGG + Intergenic
1128951353 15:71886404-71886426 GAGGGTATGGGAAATGAAGAAGG + Intronic
1129020554 15:72513809-72513831 GAGGGGGAGGGAGAGGGGGAGGG - Intronic
1129044954 15:72725920-72725942 GGGGGAAGGGGAAAGGGGGAAGG - Intronic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129275658 15:74443588-74443610 GAGGGTGAGGGAAAGCTTCATGG - Intergenic
1130130404 15:81136359-81136381 AAGGGGAAGGGAAAGGAAGAAGG + Intronic
1130311910 15:82763682-82763704 GAGGGAAAGGCAAAGGCAGATGG - Intronic
1130341021 15:82999160-82999182 GAGGGTGAGGGAGAGGGGGAGGG + Intronic
1130391525 15:83459979-83460001 GAGGGAAAGGGAAAGGGGAAAGG - Intronic
1130428545 15:83823196-83823218 GAGGGTGAGGGAGAGGGTGAGGG + Intronic
1130428553 15:83823208-83823230 GAGGGTGAGGGGGAGGGGGAGGG + Intronic
1130570602 15:85039931-85039953 GAGGGTAGGGGAGTGGTAGATGG + Intronic
1130710848 15:86279591-86279613 GAGAATAAGGGAGAGGTGGGAGG - Intronic
1130761529 15:86825651-86825673 GAAGGGAAGGGAAAGAGGGAGGG + Intronic
1130991264 15:88877410-88877432 GAGGGGAAGGGGAACGGGGAGGG + Exonic
1131126987 15:89867018-89867040 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
1131153129 15:90059410-90059432 GAGGGGAAGGGAATGGTCCAAGG - Intronic
1131379402 15:91951221-91951243 GAGGGTAAGGGAACAGGGGATGG - Intronic
1131438240 15:92439792-92439814 GAGGGGAGGGGAAAGGAAGAAGG + Intronic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131731206 15:95283308-95283330 GAAGGCAAGGGATATGTGGAAGG + Intergenic
1131851535 15:96548932-96548954 GAAGGGAAGGGAAAGGAGAAAGG + Intergenic
1132023493 15:98384878-98384900 AAGGGAAAGAGAAAGATGGAAGG + Intergenic
1132240395 15:100253355-100253377 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240399 15:100253367-100253389 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240403 15:100253373-100253395 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240407 15:100253385-100253407 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240411 15:100253391-100253413 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240415 15:100253403-100253425 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240419 15:100253409-100253431 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240423 15:100253421-100253443 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240427 15:100253427-100253449 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240431 15:100253439-100253461 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240435 15:100253445-100253467 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240439 15:100253457-100253479 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240443 15:100253463-100253485 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240454 15:100253493-100253515 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240477 15:100253553-100253575 GAGGGAAAGGGAGAGGAGGAGGG + Intronic
1132299499 15:100767340-100767362 GAGGGAAGGGGAAAGGAGGACGG - Intergenic
1132325741 15:100968714-100968736 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1132399306 15:101495758-101495780 GGGGGGAAGGGAAGGGAGGAGGG + Intronic
1132755877 16:1485138-1485160 GAGGGAACGGGAAAGGAAGAAGG + Intergenic
1133368314 16:5228592-5228614 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1133786963 16:8981462-8981484 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1133826669 16:9284160-9284182 GAGGGGAAGGGAAAAATGCAAGG - Intergenic
1133883823 16:9807364-9807386 GAGGGGGAGGGAGAGGGGGAGGG + Intronic
1133924360 16:10181767-10181789 GAGGGAGAGGGAAAGCGGGAGGG - Intronic
1133964245 16:10519419-10519441 GAGGGGAAGGGGAAGGGGAACGG - Intergenic
1134129997 16:11642760-11642782 GAGGGTTTGGGAAAGGTGGGGGG - Intergenic
1134205562 16:12235004-12235026 GAGAGACAGGGAAAGGAGGAAGG - Intronic
1134291709 16:12907034-12907056 GAGGGAAGGGGGAAGGGGGATGG - Intronic
1134368304 16:13599773-13599795 GAAGGAAAGGGAAAAGAGGATGG + Intergenic
1134632233 16:15765130-15765152 GATGGTAGGTGGAAGGTGGATGG + Intronic
1134770630 16:16806105-16806127 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1134854484 16:17506850-17506872 GAGGGAGAGGGAGAGGTAGAGGG + Intergenic
1134882161 16:17754622-17754644 GAGGGAAAGGGAAAGGGAGAAGG - Intergenic
1134902343 16:17949797-17949819 GAAGGAAAGGCAAAGGGGGAGGG + Intergenic
1135416087 16:22268988-22269010 GAGGATGTGGGGAAGGTGGAAGG - Intronic
1135431967 16:22392299-22392321 GGAGGTTAGGGAAGGGTGGAAGG - Intronic
1135467388 16:22698956-22698978 GTGGGAGAGAGAAAGGTGGAGGG - Intergenic
1135624309 16:23981841-23981863 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1135632625 16:24047962-24047984 AAGGGTGAGGGAAGGGAGGAGGG + Intronic
1135667955 16:24351622-24351644 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1135811143 16:25588032-25588054 GAGGGGAAGGGAGGGGTGGAAGG - Intergenic
1135903560 16:26489538-26489560 GAGGGCAAGGGAAGGGAAGATGG - Intergenic
1136019581 16:27431434-27431456 GAGGCTAAGAGACAGGTGCATGG + Intronic
1136251638 16:29009372-29009394 GAGGGGCAGGGAGAGGAGGAGGG - Intergenic
1136255835 16:29038448-29038470 GAGGGGAAGGGAAAGGAGAAGGG - Intergenic
1136276180 16:29180621-29180643 GAGGGCCAGGGAGAGGTGTAAGG - Intergenic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1136589044 16:31206219-31206241 GAAGGAAAGGGAAGGGAGGAAGG - Intergenic
1137232360 16:46578192-46578214 GAGGGAAAGGGAAAGGGAAAGGG + Intergenic
1137232376 16:46578230-46578252 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1137232398 16:46578284-46578306 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1137348262 16:47685097-47685119 TAGGGAAAGGAAAAGATGGATGG - Intronic
1137430973 16:48417515-48417537 GAGGGAGAGGGAAACGGGGAGGG + Intronic
1137464678 16:48697476-48697498 GAGGGAGGGGGTAAGGTGGATGG + Intergenic
1137493307 16:48951101-48951123 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137799411 16:51248493-51248515 GAGGGAAAGGGAAAGGGAAAGGG - Intergenic
1137975170 16:53025124-53025146 GAGGCCAAGGCCAAGGTGGAAGG + Intergenic
1138101645 16:54256661-54256683 GAGGATTAGAGAAAGGAGGAGGG - Intronic
1138227700 16:55311975-55311997 GTGGGTAGGGAAAAGGGGGAAGG - Intergenic
1138396589 16:56709343-56709365 GAGACAAAGGGAAAGGTGGAGGG + Intronic
1138444416 16:57054669-57054691 GAGGGTAAGGAAAGGGAGGGTGG - Intronic
1138642765 16:58397826-58397848 GAGGGAGAGGGAAAGGGAGAGGG + Intronic
1138973048 16:62170120-62170142 AGGGGTAAGGGCAAGGTGGGAGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139292414 16:65870719-65870741 GAGGGAGAGGGAAAGGAGGGAGG + Intergenic
1139320430 16:66109757-66109779 GAAGGGAAGGGAAGGGGGGAAGG + Intergenic
1139363648 16:66419348-66419370 GAGGGGAAGGGAAGGAGGGAGGG + Intergenic
1139413922 16:66790302-66790324 GAGGAGAAGGGAAAGGAGGGAGG + Intronic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139556157 16:67712291-67712313 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
1139569938 16:67805699-67805721 GGAGGTGAGGCAAAGGTGGAAGG - Intronic
1140400313 16:74666044-74666066 GAGGGAGAGGGAGAGGCGGAGGG + Intronic
1140603495 16:76506419-76506441 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1140655131 16:77132350-77132372 GAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1140944901 16:79758703-79758725 GAGTGTGAGAGAAAGGAGGACGG + Intergenic
1141190897 16:81823939-81823961 AAGGGAAAGGGAAAGGAGGAAGG - Intronic
1141265716 16:82495204-82495226 GAAAGTAAGGGAAAGAAGGAAGG - Intergenic
1141812312 16:86383698-86383720 GAGGGAAAGGGAAGGGAGGATGG + Intergenic
1141896052 16:86959365-86959387 AAGGGGAAGGGGAAGATGGATGG + Intergenic
1142011607 16:87718301-87718323 GAGGGGGAGGGAGAGGGGGAGGG - Intronic
1142080559 16:88146680-88146702 GAGGGCCAGGGAGAGGTGTAAGG - Intergenic
1142353120 16:89588814-89588836 GGGGGTGAGGGGAAGGTGGTGGG - Intronic
1142986176 17:3696406-3696428 GAGAGGAAGTGAAAGGGGGAAGG + Intergenic
1143005164 17:3827077-3827099 GGGGGAAAGGGGAAGGGGGAAGG + Intronic
1143048339 17:4100966-4100988 GAGGGGAAGGGAAAGGGACAAGG + Intronic
1143096383 17:4480667-4480689 GCGGGTGGGGGAAGGGTGGAAGG + Intronic
1143384356 17:6518741-6518763 GAGAGAAAGAGAAAGATGGAGGG + Intronic
1143474034 17:7192864-7192886 GAGAGTTAGAGAAAGCTGGAGGG + Intronic
1143651650 17:8267196-8267218 GAGGCTTTGGGAAAGGTGGGGGG - Exonic
1143887550 17:10076235-10076257 GAGGGAGAGGGACAGGGGGACGG + Intronic
1143981303 17:10872545-10872567 GAGGCAAAGGGAAGGGTGGGAGG + Intergenic
1145279715 17:21458313-21458335 GAGGCTGAAGGAAAGGGGGAGGG + Intergenic
1145296760 17:21598804-21598826 GAAGGGAAGGGAGGGGTGGATGG + Intergenic
1145398165 17:22512169-22512191 GAGGCTGAAGGAAAGGGGGAGGG - Intergenic
1145888046 17:28396409-28396431 GAGGGTGGGGGACAGGGGGAGGG - Exonic
1146147449 17:30433103-30433125 GAGGGAATGGGAAAAGTGGAAGG - Intronic
1146274305 17:31506532-31506554 GAGGGTAGGAGAAGGGAGGACGG - Intronic
1146742743 17:35300995-35301017 GAGGGTAAGCCAAAGCAGGATGG + Intergenic
1146790492 17:35747962-35747984 GAGGTTAAGGGCGGGGTGGAGGG + Intronic
1146827977 17:36040626-36040648 GACTGAAGGGGAAAGGTGGAGGG + Intergenic
1146978261 17:37135015-37135037 GAGGGGGAGAGAAAGGAGGAAGG + Intronic
1147575377 17:41595888-41595910 GAGGGAAAGGGAAAGAGGAAGGG + Intergenic
1147760544 17:42795149-42795171 GAGGGGAAGGAAGAAGTGGAGGG - Exonic
1147847675 17:43416500-43416522 CAGGGTAAAGGAAAGGTGTGGGG - Intergenic
1147996283 17:44362134-44362156 CAGGTTGAGGGAAAGGGGGAAGG - Intronic
1148150708 17:45395231-45395253 GACGGGAAGGGAAGGGGGGATGG + Exonic
1148404091 17:47397030-47397052 GAGGGAAAGGGGGAGGGGGAGGG - Intronic
1148550387 17:48546784-48546806 GAGGGTGGGGGAGAGGAGGATGG + Intergenic
1148550773 17:48549814-48549836 GAGGTTTTGGGAAAGTTGGAAGG + Exonic
1148985022 17:51613472-51613494 GAGGGGGAGGGAGAGGGGGAGGG - Intergenic
1149027995 17:52052135-52052157 GAGGGTGGGGGAAGGGAGGAGGG + Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149168883 17:53785724-53785746 GAAGGAAAGGGAAAGGGGAAGGG + Intergenic
1149433395 17:56613150-56613172 GAGAGGAAGAGAAAGGGGGAAGG - Intergenic
1149442919 17:56690325-56690347 GAGGTTAAGGGAAAGATTCAAGG - Intergenic
1149659633 17:58327569-58327591 GAAGGTAAGGGATCTGTGGAGGG - Exonic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1149809399 17:59653535-59653557 GAGGGAAAGGGAAAGAAAGAGGG - Intronic
1150293133 17:63993176-63993198 GAGGGTAAGGGAGGGAAGGAAGG + Intergenic
1150519566 17:65852268-65852290 GAGGGGAAGGGAAGGAGGGAGGG - Intronic
1150519574 17:65852286-65852308 GAAGGGAAGGGAAGGGAGGAGGG - Intronic
1150519593 17:65852337-65852359 GAGGGGAAGGGAAGGAGGGAGGG - Intronic
1150645735 17:66976471-66976493 GAGGATAGAGGAAAGCTGGAAGG - Intronic
1150685323 17:67316080-67316102 GAAGGGAAGGGAAAGGGGAAGGG - Intergenic
1150760854 17:67959660-67959682 GAGGGGGAGGTGAAGGTGGAGGG - Exonic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1151210118 17:72538159-72538181 GAGGGTGATGGAAAGGGTGATGG + Intergenic
1151327683 17:73388974-73388996 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1151507962 17:74541791-74541813 AAGGGTCAGGGGATGGTGGAGGG - Intronic
1151627689 17:75287775-75287797 AGGGGAAAGGGAAAGGTGAAGGG - Intronic
1152417336 17:80171146-80171168 GAGGGGAAGGGGAAGGTGAATGG - Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152928375 17:83098228-83098250 GAGGGAAAAGGGCAGGTGGAGGG - Intergenic
1153168298 18:2286704-2286726 GAGGGTGAAGGGTAGGTGGAGGG - Intergenic
1153278208 18:3389955-3389977 GAAGGAAAGGGAAAGGAGAAAGG + Intergenic
1153804702 18:8702301-8702323 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1155287833 18:24309425-24309447 GAGGGAAAGGCTGAGGTGGAAGG - Intronic
1155381192 18:25224514-25224536 GAGGGGAAAGGCAAGGTGGGGGG - Exonic
1155404623 18:25474192-25474214 GAGGTTAAGGGACTTGTGGAAGG + Intergenic
1155764433 18:29609841-29609863 GAGGGAAAGGGAGAGATGAATGG - Intergenic
1156042889 18:32843391-32843413 GTGGGTAAGGGAAATGTAGTAGG - Intergenic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1156261797 18:35451438-35451460 GAGGGAGAGGGAAATGGGGAAGG + Intronic
1156421547 18:36959582-36959604 GAGGAGAAAGGAAAGGGGGAGGG - Intronic
1156457278 18:37301907-37301929 GGGGGAAGGGGAAAGGTGGGTGG - Intronic
1156700494 18:39819065-39819087 GAGGGGAAGGGAAGCGGGGAAGG + Intergenic
1156826338 18:41434443-41434465 GTGGGGGAGGGAAAGGAGGAAGG + Intergenic
1157302016 18:46485957-46485979 GAGGGAGAGGGAAAGAGGGAAGG - Intronic
1157432903 18:47644208-47644230 GAGGGTGAAGGGAAGGTGGTTGG + Intergenic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157972057 18:52282044-52282066 GAGGGAGAGGGATAGGTGAAGGG + Intergenic
1158063179 18:53372457-53372479 GAGGGTAAAGGGTAGGGGGAGGG + Intronic
1158393449 18:57061987-57062009 GCAGGAAAGGGAAAGGTGAAGGG + Intergenic
1158736444 18:60087226-60087248 GATGGCCAGGGAAAGGAGGATGG + Intergenic
1158803904 18:60946706-60946728 TAGGGTAAGATAAAGGTTGAGGG - Intergenic
1159247686 18:65830592-65830614 GAAGGAAAGGGAAGGGGGGAGGG - Intronic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1159850663 18:73523322-73523344 GAGAGGAAGGGAAGGGAGGAAGG + Intergenic
1159850978 18:73527012-73527034 GGGGGAGAGGGAAAGGAGGAGGG - Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160002048 18:75033870-75033892 GAGGGTCAGGGAAAGGAGAAGGG - Intronic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160819764 19:1052490-1052512 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
1160819783 19:1052533-1052555 GAGGGGAAGGGAGAGGAGGAGGG + Intronic
1161022248 19:2015808-2015830 GAGGGGAGGGGAAAAGAGGAGGG + Intronic
1161139311 19:2638396-2638418 GATGGGAAGGGAAAGGGGGAGGG + Intronic
1161139637 19:2639812-2639834 GAGGGTAAGGGAGGGAGGGAGGG + Intronic
1161287939 19:3478484-3478506 GAGATAAAGGGAAAGGTGGAAGG + Intronic
1161366955 19:3885602-3885624 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1161415744 19:4145483-4145505 GAGGGTGAGAGAGAGGAGGAGGG + Intergenic
1161821433 19:6533261-6533283 GAGGGAAGGGGACAGGAGGAGGG - Intronic
1161942034 19:7411268-7411290 GAGGGAAAGGGAAAGGGGAAGGG - Intronic
1162437382 19:10669777-10669799 GATGGTAATGAAGAGGTGGAAGG - Intronic
1162686187 19:12386485-12386507 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1162686192 19:12386497-12386519 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1162704243 19:12543333-12543355 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162783240 19:13018217-13018239 GAGGGTAAGGGAGATGTGCCTGG + Intronic
1162867582 19:13560512-13560534 GAGGGGAAGTGAAAGAGGGAAGG - Intronic
1163004561 19:14389259-14389281 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
1163101397 19:15099188-15099210 AAGGGAAAGGGAAAGGGGAAGGG + Intergenic
1163370959 19:16901049-16901071 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1163418640 19:17202041-17202063 CAGGGTATGGGAAAGGCTGAAGG - Intronic
1163488464 19:17603411-17603433 GAGGGTAGGGGTCGGGTGGATGG - Exonic
1163549417 19:17957248-17957270 AAGGGAAAGGGAAAGGGGAAAGG + Intronic
1163570975 19:18082119-18082141 GAGGGTTTGGGAATGGTAGAGGG + Intronic
1163701926 19:18790431-18790453 GAGGCTGACGGAGAGGTGGACGG - Intronic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1163896640 19:20065267-20065289 GAGGGAAAGGGAGAGGGAGAGGG + Intergenic
1164082003 19:21866845-21866867 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164544855 19:29151867-29151889 AAGGGAAAGGGAAAGGAGGAAGG + Intergenic
1164772005 19:30816498-30816520 GAGAGGAAGGGAAAGAAGGAAGG - Intergenic
1164956641 19:32392223-32392245 GAGGGGAAGGGAAAGAAAGAAGG + Intergenic
1165400406 19:35596097-35596119 AAGGGAAAGGGAAAGGGGAAGGG + Intergenic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165752400 19:38268212-38268234 GGTGGGAAGGGACAGGTGGACGG + Intronic
1165762338 19:38328892-38328914 GAAAGAAAGGGAAAGATGGAAGG + Exonic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1165911335 19:39230071-39230093 GGGGGGAAGGGAAAGGGGAAAGG + Intergenic
1165968430 19:39604566-39604588 GAGAGTAAGTGAGAGGTGCAGGG - Intronic
1166034965 19:40161432-40161454 AAGGGGAAGGGAAAGGGAGAGGG + Intergenic
1166034971 19:40161450-40161472 GAGGGAAAGGGAAAGGGAGAGGG + Intergenic
1166158418 19:40933159-40933181 GGGGGTAGGGGAAAGAGGGAGGG + Intergenic
1166163278 19:40967437-40967459 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1166203647 19:41254576-41254598 GAGGGTAAGGGGAGGGTAGAAGG + Intronic
1166329779 19:42071118-42071140 GAGGCAGTGGGAAAGGTGGATGG + Intronic
1166422864 19:42652363-42652385 GAAGATGAGGGAAATGTGGACGG - Intronic
1166654560 19:44601024-44601046 GAGGGTAGGGGAAGGGAGAATGG - Intergenic
1166672931 19:44722417-44722439 GAGGGTCAGGGACAGGCTGAGGG - Intergenic
1166933618 19:46317478-46317500 GAGGGTAAGTGAGAAGGGGAGGG - Intronic
1167038192 19:47006664-47006686 GAGGTTTGGGGAAGGGTGGATGG - Intergenic
1167067227 19:47195657-47195679 AAGGGAAAGGGAAAGGGGAAGGG - Intronic
1167331023 19:48856254-48856276 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167797632 19:51719981-51720003 GAGGGAAAGGGAAGGAGGGAAGG - Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167913446 19:52721721-52721743 GAGGGAGAGGGAAAGGGAGAGGG + Intronic
1167952207 19:53036919-53036941 GAGAGTGAGGGAGAGGAGGAGGG - Intergenic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168296659 19:55380329-55380351 GAGGGGAGGGGGAAGGGGGAAGG - Intronic
925199244 2:1952890-1952912 GAGAGGAAGGGAAAGAAGGAGGG - Intronic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
925573390 2:5334857-5334879 GAAGGGAAGGGAAAGGGGAAGGG + Intergenic
925648922 2:6068081-6068103 GAGAGAAAGAGAAAGGAGGAGGG - Intergenic
925684057 2:6453212-6453234 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925733275 2:6938226-6938248 GAGGGGAGGGGAGAGGGGGAGGG - Intronic
926215726 2:10903882-10903904 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926874561 2:17460659-17460681 GAGGGGGAAGGAAAAGTGGAGGG + Intergenic
927038413 2:19204187-19204209 GGGGGTGAGGGAGAGGAGGAGGG - Intergenic
927236166 2:20876859-20876881 GAGGATGACGGAGAGGTGGATGG + Intergenic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927739642 2:25556767-25556789 GTTGGTAAGGGAAAGCTGGGAGG + Intronic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927894738 2:26774445-26774467 GAGGGAAAGAGAGAAGTGGATGG - Intronic
927906824 2:26864512-26864534 CACGGAAAGGAAAAGGTGGATGG + Intronic
928081328 2:28315053-28315075 GAGGGGAGGGGAAAGGGGGGAGG + Intronic
928196239 2:29218554-29218576 GAGGGAGAGAGAAAGGGGGAGGG + Intronic
928280074 2:29938154-29938176 GAGGGCAGGGGGAAGGGGGAGGG + Intergenic
928452569 2:31389443-31389465 GAGGGGAAGTGCAAGGTGGCTGG - Intronic
928536302 2:32244868-32244890 GAGGGGAAGGGAGAGGAAGAAGG + Intronic
928652664 2:33419016-33419038 GAGGGTAGCGGGTAGGTGGATGG + Intergenic
929189389 2:39125077-39125099 GAGGGTGAGGGAAAGACAGAGGG - Intergenic
929252953 2:39779347-39779369 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
929304154 2:40340816-40340838 GAGGGTAAGAAAAAGTTTGAAGG + Intronic
929365395 2:41149603-41149625 GAGTGTGGGGAAAAGGTGGAAGG - Intergenic
929404354 2:41624788-41624810 GAGAGGAAGAGAAAGGGGGAAGG - Intergenic
929481218 2:42310293-42310315 AAGGGGAAGGGAAAGGGGAATGG - Intronic
929481222 2:42310305-42310327 AAGGGAAAGGGAAAGGGGAAGGG - Intronic
929533001 2:42763983-42764005 GAGGGTGAGGGAGAGAAGGAGGG + Exonic
929739344 2:44587450-44587472 GAGGGAGAGGGACAGGGGGAGGG - Intronic
929798031 2:45075222-45075244 GAGGGCAAGGGAGATGGGGAAGG - Intergenic
929927784 2:46229928-46229950 GAGAGTGAGGGAGAGCTGGAGGG - Intergenic
930092472 2:47541191-47541213 GAGGACAAGGGAAAGAGGGAGGG - Intronic
930288514 2:49465326-49465348 AAGGGAAAGGGAAAGGGGGGAGG - Intergenic
930288518 2:49465332-49465354 GAGGGAAAGGGAAAGGGAAAGGG - Intergenic
930622553 2:53659004-53659026 GAGGGGAAGGGAGGGGAGGAAGG + Intronic
931364946 2:61611270-61611292 AAGGGTAAGAGAAAGGAAGAAGG + Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931796152 2:65712148-65712170 AAGGGGAAGGGAAAGAAGGAAGG - Intergenic
932186558 2:69701667-69701689 GAGGGTGGGGGAAATGTGGCTGG - Intronic
932331378 2:70900274-70900296 TAGGCTAGGGGAACGGTGGAGGG + Intergenic
932356677 2:71073268-71073290 CAAGATAAGGGAAAGTTGGAGGG - Intronic
932566744 2:72915784-72915806 GAGGGTGGGGAAAAGGAGGAGGG + Intergenic
932626419 2:73299828-73299850 GAGGGTCAGAGGTAGGTGGACGG + Intergenic
933099411 2:78233187-78233209 GTGGCTAAAGGAAAGGAGGATGG + Intergenic
933734750 2:85486876-85486898 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
933853006 2:86385878-86385900 GAGGACAAGAGAAAAGTGGAGGG - Intergenic
933898919 2:86835509-86835531 GAGGCTGAGGTAAGGGTGGAGGG + Intronic
935008989 2:99113367-99113389 GGGGGAGAGGGGAAGGTGGAGGG + Intronic
935279967 2:101508412-101508434 GAGGGGACGGGAGAGGTGAATGG + Intergenic
935308315 2:101759454-101759476 GAGGGAAAGGGAAAGGGAAATGG - Intronic
935781627 2:106513717-106513739 GAGGCTGAGGTAAGGGTGGAGGG - Intergenic
936276681 2:111103972-111103994 GAGGGTAAAGGAAGGGAAGAGGG - Intronic
936536508 2:113315791-113315813 GAGGGGAAGGGTAAAGTGAAAGG + Intergenic
936770122 2:115902460-115902482 AAGGGAAAGGGAAAGAGGGAAGG - Intergenic
937400892 2:121582617-121582639 AAGGGAAAGGGAAAGGGGAAGGG + Intronic
937515506 2:122650645-122650667 GAGAGTGAGGGCAAGGTGGGTGG + Intergenic
937555147 2:123144908-123144930 GAGGGGAAGGGAAAGATGACTGG - Intergenic
937690684 2:124751342-124751364 GAAGATAAAGGAAAGGAGGAAGG + Intronic
937871987 2:126792575-126792597 TAGAGCAAGGGAAAGGAGGAAGG - Intergenic
938043423 2:128095407-128095429 GAGGGGAAGGGGAAGGTAAAGGG - Intronic
938077043 2:128345666-128345688 GGAGGGAAGGGAAAGGCGGAGGG + Intergenic
938083140 2:128380870-128380892 GAGGGTGAGGGAGAGGAGCAGGG - Intergenic
938760413 2:134420564-134420586 GTGGCTAAGGGAAAGACGGAGGG + Intronic
938822134 2:134969382-134969404 GAGGGAGAGGGAAAGGGAGAGGG + Intronic
939476025 2:142687171-142687193 GAGGGGAGGGGAAGGGGGGAGGG + Intergenic
939547617 2:143572414-143572436 CAGGGCAAGGGAAAGGGAGAGGG - Intronic
939687982 2:145223390-145223412 GTGGGTAAGGGAAATGTGAAAGG + Intergenic
939787697 2:146537454-146537476 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
940372941 2:152922907-152922929 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941197405 2:162469683-162469705 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
941271396 2:163433456-163433478 GAGGGAAAGGGTAAGGTAGAGGG + Intergenic
941575614 2:167226608-167226630 GAGGGCAAGGGAAAAATGAATGG - Intronic
942414208 2:175741274-175741296 GAAGGGAAGGGAAGGGAGGAGGG + Intergenic
942574222 2:177346066-177346088 GAGGTAAAGGGAAAAGTGAATGG + Intronic
942629232 2:177938111-177938133 GAGTGAAAGGGAAGGTTGGAAGG + Intronic
943301442 2:186207481-186207503 GAAAGGAAGGGAAAAGTGGATGG - Intergenic
943394278 2:187313016-187313038 GAGGGGAGGGGAGGGGTGGAGGG + Intergenic
943604528 2:189961275-189961297 GAGGGCCAGGAGAAGGTGGAGGG + Intronic
943770839 2:191714571-191714593 GGAGGTAATGAAAAGGTGGAGGG + Intergenic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
943979040 2:194523378-194523400 GGGGGTAGGGGAAAAGGGGAGGG - Intergenic
944135814 2:196398087-196398109 GAGTGTAGGGGAAAGGTGGCTGG + Intronic
944255145 2:197618056-197618078 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
944306311 2:198183824-198183846 GAAGGTAAGGGCATGGTGGGAGG + Intronic
944527592 2:200635777-200635799 GAGAGTAAGGGAAATGAGGCAGG + Intronic
944533234 2:200684739-200684761 GAGGGGGAGGGAGAGGGGGAGGG + Intergenic
944677898 2:202049409-202049431 GAAGGGAAGGGAAAGGTGAAGGG + Intergenic
945154380 2:206823280-206823302 GCAGCTAAAGGAAAGGTGGAAGG + Intergenic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945590637 2:211725840-211725862 GAAGGGGAGGGAAAGGAGGAAGG + Intronic
945851181 2:215009294-215009316 GAGGGGAACAGAAGGGTGGAGGG + Intronic
946026795 2:216676720-216676742 GGGGGTGAGGGAAAGGTTGGGGG + Exonic
946109626 2:217403189-217403211 GAGGAGAAGGGAGAGGGGGAGGG + Intronic
946185451 2:217978418-217978440 GGGGGAGAGGGAAAGGGGGAGGG - Intronic
946186346 2:217982885-217982907 TAGGGTAAGGGAAGTGAGGAAGG - Intronic
946192734 2:218016041-218016063 GAGGGCCAGGGAAAGGGGGAGGG + Intergenic
946400359 2:219465284-219465306 GAGGCGAAGGGTGAGGTGGAAGG - Intronic
946433141 2:219636085-219636107 GAGGGTGTGGGAGAGGTGTAAGG + Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
947380836 2:229544002-229544024 GAGGGTAAGGGCAAGTGGGGTGG - Intronic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947505595 2:230706123-230706145 GAGGGTGTGGGTAGGGTGGAAGG + Intergenic
947511007 2:230754385-230754407 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511014 2:230754403-230754425 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947511020 2:230754421-230754443 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511027 2:230754439-230754461 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947661201 2:231869972-231869994 GAGGGAAAAGGAAGGGGGGAGGG - Intergenic
947795338 2:232890744-232890766 GAGGGTGACGGAAACGGGGAAGG - Intronic
947796485 2:232896808-232896830 GAGGGTAGGGGTAAGGGTGAGGG + Intronic
948041583 2:234905679-234905701 GAGGGAAAGGGAAAAGAGAAAGG + Intergenic
948344332 2:237282667-237282689 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948344346 2:237282697-237282719 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948605205 2:239130632-239130654 GAGGGAAGGGCACAGGTGGAGGG - Intronic
948763232 2:240205348-240205370 GAGGGAAAGGGAGAGAGGGAAGG + Intergenic
948911048 2:241002869-241002891 GAGGGTGAGGGAGAGGAGGGAGG - Intronic
949027489 2:241773418-241773440 GAGGGTTAGGGGCAGGTGGAGGG + Intergenic
1169219780 20:3815237-3815259 GAGGGTAAGGGAAAGAACGAGGG + Intergenic
1169608170 20:7347534-7347556 GAGGGAAAGTGAAAGGTCAAGGG + Intergenic
1169709767 20:8548376-8548398 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1169962369 20:11175596-11175618 GAGTGTAATGTAAATGTGGAGGG + Intergenic
1170355776 20:15490228-15490250 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1171355807 20:24544665-24544687 TGGGGTAAGGGAAAGTTTGAAGG + Intronic
1171364522 20:24614637-24614659 GAGGGGAGGGGAAAGGAGGGAGG + Intronic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171474534 20:25397861-25397883 AAGGGAGAGGGAAAGGGGGAGGG + Intergenic
1172192294 20:33069283-33069305 GAGGGTCAGAGGAAGCTGGAGGG - Intronic
1172401765 20:34657932-34657954 GAGGGTGAGGGAGAGGGAGAGGG - Intronic
1172696430 20:36826311-36826333 GAGGGGGAGGGAGAGGGGGAGGG - Intronic
1172696440 20:36826329-36826351 GAGGGGGAGGGAGAGGGGGAGGG - Intronic
1172717956 20:36977761-36977783 GAGGGTGAGGGAGAGGGAGAGGG + Intergenic
1172806967 20:37619030-37619052 GAAGGAAAGGGAAAGGAGAAAGG - Intergenic
1172842918 20:37912783-37912805 GAGAGTAAGGGGCCGGTGGAGGG - Intronic
1172898321 20:38316191-38316213 GAGGGGAAGAGAAAGAAGGAAGG - Intronic
1173304775 20:41837697-41837719 GAGGGTAGGGGCATGGGGGATGG - Intergenic
1173541696 20:43857402-43857424 GAGGGAGAGGGAAAGGGAGAAGG + Intergenic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173789643 20:45819637-45819659 GAGGGTCAGGGAAAGGTTTTTGG + Intergenic
1173861900 20:46289240-46289262 GGTTGTAAGGGAAAGGTGCATGG - Intronic
1174275234 20:49398839-49398861 GAGGGTGAGAGAGAGGTGCAGGG - Intronic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174670981 20:52307521-52307543 GAGGGGAAGGGAGAGGCAGAGGG - Intergenic
1174835611 20:53853608-53853630 GAGGGGAGGGGAAGGGAGGAGGG + Intergenic
1174899932 20:54488745-54488767 GAGGGGTAGGGAAAGAGGGAGGG - Intronic
1175100616 20:56576229-56576251 GAGGGCAAGGGGAAGGGGCAGGG - Intergenic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175142777 20:56873198-56873220 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175919644 20:62444709-62444731 CAGGGGATGGGAGAGGTGGATGG + Intergenic
1175921378 20:62451943-62451965 GAGAGGGAGGGAAAGGGGGAGGG + Intergenic
1175967344 20:62666135-62666157 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1176293542 21:5058895-5058917 GAGGGGAGGGGATAGGGGGAGGG - Intergenic
1176348608 21:5771826-5771848 GAGGGTGAGGGAGAGGGAGAGGG + Intergenic
1176355422 21:5892410-5892432 GAGGGTGAGGGAGAGGGAGAGGG + Intergenic
1176496219 21:7552629-7552651 GAGGGTGAGGGAGAGGGAGAGGG - Intergenic
1176542929 21:8169896-8169918 GAGGGTGAGGGAGAGGGAGAGGG + Intergenic
1176561880 21:8352941-8352963 GAGGGTGAGGGAGAGGGAGAGGG + Intergenic
1176678751 21:9805909-9805931 GAGGGCAGGGGAGAGGTGGGCGG - Intergenic
1177279607 21:18964027-18964049 CAGGGAAAGGGAAAGGGGAAGGG + Intergenic
1178319866 21:31597207-31597229 GAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1178339777 21:31776349-31776371 GAGAGGAAGGGAAAGCTAGAGGG - Intergenic
1178480848 21:32978316-32978338 GAGGTTAAAGGAAAGATTGATGG - Intergenic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1179135845 21:38678963-38678985 GAGGGGAGGGGAGAAGTGGAGGG + Intergenic
1179215919 21:39366944-39366966 GAGGGGAGGGGAAAGGGGGAAGG - Intergenic
1179863718 21:44204753-44204775 GAGGGGAGGGGATAGGGGGAGGG + Intergenic
1180074033 21:45453691-45453713 GTGGGCAGGGGAAGGGTGGAGGG + Intronic
1180295248 22:10928503-10928525 GAGGGAAAGGGAAGGAAGGAAGG - Intergenic
1180872501 22:19154584-19154606 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181549879 22:23631745-23631767 GAGGGTAAGGGAAGGGGGTGGGG + Intronic
1181798513 22:25327787-25327809 GAGGGTAAGGGAAGGGGGTGGGG - Intergenic
1181977217 22:26738498-26738520 GAGGGAGAGGGAGAGGGGGAAGG - Intergenic
1182276907 22:29195541-29195563 GAGGGAAAGGGGACGGTGTAGGG + Intergenic
1182342000 22:29630671-29630693 GAAGGAAAGAGAGAGGTGGAGGG - Intronic
1182461512 22:30486960-30486982 GAGGCCAAAGGAAAGCTGGAAGG - Intergenic
1182851631 22:33479401-33479423 GAGGGAAAGGGAAGGGAGAAAGG + Intronic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1183404720 22:37624850-37624872 GAGGGGAAGGGAAAGGGGCAGGG - Intronic
1183440518 22:37820462-37820484 GAAGGGAGGGGAGAGGTGGAGGG - Intergenic
1183491142 22:38116252-38116274 TGGGGAAAGGGAAAGGTGGATGG - Intronic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1184202444 22:42980492-42980514 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
1184254691 22:43280412-43280434 GAGGGGAAGGGACAGGAGGATGG - Intronic
1184254700 22:43280437-43280459 GAGGGGAAGGGACAGGGGGATGG - Intronic
1184254711 22:43280462-43280484 GAGGGGAAGGGACGGGAGGATGG - Intronic
1184254731 22:43280510-43280532 GAGGGGAAGGGACAGCAGGATGG - Intronic
1184254739 22:43280535-43280557 GAGGGGAAGGGACAGGAGGATGG - Intronic
1184378673 22:44131441-44131463 GAGGGTCAGAAAAAGCTGGAAGG - Intronic
1185114458 22:48923689-48923711 GAGTAGAATGGAAAGGTGGAGGG + Intergenic
1185399828 22:50610087-50610109 GAGGGTAAGGGACAGGAGTGTGG - Intronic
1203247796 22_KI270733v1_random:86139-86161 GAGGGTGAGGGAGAGGGAGAGGG + Intergenic
949090415 3:21316-21338 TAAGGTCAGGGAAAGGTTGAGGG + Intergenic
949382835 3:3465029-3465051 GAGGGAAGGGGAGAGGGGGAAGG + Intergenic
949401060 3:3665821-3665843 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
949778137 3:7654936-7654958 GAGGGAAAGGGAAGAGAGGAAGG - Intronic
950044439 3:9940710-9940732 GAGGGAGAGGGAAAGGGGGAGGG + Intronic
950044443 3:9940716-9940738 GAGGGAAAGGGGGAGGGGGAGGG + Intronic
950139693 3:10606936-10606958 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
950185021 3:10939564-10939586 GAGGTTAGGGGACAGGAGGAGGG - Exonic
950319806 3:12040749-12040771 GAGGATAAAAGAAAGATGGAAGG + Intronic
950582045 3:13868763-13868785 GAAGGGAAGGGAAGGGAGGAAGG + Intronic
951296068 3:20936432-20936454 GATGGTATGGGAATGGTGGAGGG - Intergenic
952114352 3:30161365-30161387 GAAGGGGAGGGAAAGGAGGAAGG - Intergenic
952125257 3:30292248-30292270 GAGAGGAAAGGAAAGGTGAAAGG - Intergenic
952273773 3:31857828-31857850 GAGGGAGAGGGAAAGAGGGAGGG + Intronic
952450026 3:33422742-33422764 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
952894177 3:38065408-38065430 GAGGGAAAGGGAGAGGGAGAGGG + Intronic
953181408 3:40598254-40598276 GAGGGAAAGAGAAAGGGGAAAGG - Intergenic
953285457 3:41602324-41602346 GAAGGGAAAGGAAAGGAGGAAGG + Intronic
953306906 3:41840349-41840371 GAGGGCAAGGGAGAGGGAGAAGG - Intronic
953708313 3:45247800-45247822 GAGAGCAAGAGAAAGGTGGGAGG - Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954050929 3:47976466-47976488 CAGGGTAAGGAAAGGCTGGAGGG - Intronic
954060223 3:48061192-48061214 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
954151149 3:48657751-48657773 GGGGAGAAGGGAAAGGTGGCTGG - Intronic
954377433 3:50202519-50202541 GAGGGGAAGGGCACTGTGGATGG - Intergenic
954411764 3:50374121-50374143 GGAGGTAAGGGGAAGGAGGAAGG + Intronic
954579198 3:51694042-51694064 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
954594298 3:51812263-51812285 AAGGGTAGAGGAAAGGAGGACGG - Intergenic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
955087809 3:55720075-55720097 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
955150686 3:56363869-56363891 AAGGGAAAGGGAAAGGGGGAGGG + Intronic
955249852 3:57269202-57269224 GAGGGGAAGGGAAAGGAGTGTGG + Exonic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955578592 3:60394086-60394108 GAGGGTCAGGGTATGGGGGAAGG + Intronic
955598673 3:60620644-60620666 GAGGGGGAGGGAAAGAGGGATGG + Intronic
956096619 3:65722884-65722906 GGGGGTAGGGGAGGGGTGGAGGG + Intronic
956230142 3:67005636-67005658 GAAGGGAAGGGGAAGGGGGAGGG - Intronic
956392732 3:68790936-68790958 AAGGATAAGGCAAACGTGGATGG + Intronic
956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG + Intergenic
956988259 3:74730174-74730196 GAGAGTTAAGGAAAGGAGGAAGG - Intergenic
956993822 3:74800186-74800208 TGGGGTAAGGGAATGGGGGAAGG + Intergenic
957030310 3:75233077-75233099 TAAGGTCAGGGAAAGGTTGATGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957520356 3:81311273-81311295 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958087247 3:88826041-88826063 GAGGGGAAGGGAGAGAAGGAAGG - Intergenic
958709897 3:97705255-97705277 GAGGGGATGGGAAATGTGGGAGG - Intronic
958883075 3:99695566-99695588 GAGAGTAAGAGAAAGAGGGAGGG - Intronic
958885450 3:99721419-99721441 AAGGGAAAGGGAAAGGGGAAGGG + Intronic
958885470 3:99721473-99721495 GAGGGGAAGGGAAGCCTGGATGG + Intronic
959063641 3:101636808-101636830 AAGGGTTAGGGACAGTTGGATGG - Intergenic
959415929 3:106075779-106075801 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
960120067 3:113939682-113939704 GAGGTTGAGGAAAAGATGGAAGG - Intronic
960213414 3:114999154-114999176 GAGAGAAAGGGAAAGGGAGAGGG + Intronic
960308800 3:116095465-116095487 GAGGTTAAGAGAAGAGTGGATGG + Intronic
960428970 3:117545503-117545525 GAGAGGAAGGGAAAGGAGTAAGG + Intergenic
960741962 3:120844028-120844050 GATGGGGAGGGAAAGGTAGATGG - Intergenic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
960986023 3:123281559-123281581 GAGAGGAAGGGAGAGGTGGTAGG - Intergenic
961037780 3:123654661-123654683 GGGGGTTAGGAGAAGGTGGAGGG - Intronic
961384617 3:126516587-126516609 GAGGGAAAGGGAAATGGGGGAGG - Intronic
961474863 3:127140285-127140307 GAGGGTGAGGGAGAGGTGAGTGG + Intergenic
961522751 3:127476697-127476719 GAGGGAATGGGAAAGGAGGAAGG + Intergenic
961618856 3:128207225-128207247 GAGGGAAAGAGAGAGATGGAGGG - Intronic
961660227 3:128464791-128464813 GAAGGGAAGGGAAAGAAGGAGGG - Intronic
961729018 3:128953595-128953617 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
962513047 3:136121432-136121454 GAGGGTAGAGGATAGGAGGAGGG + Intronic
962525900 3:136237245-136237267 GAGAGAGAGGGAAAGATGGAAGG - Intergenic
962711528 3:138090610-138090632 GATGGAAAGCCAAAGGTGGAAGG - Intronic
963017094 3:140834878-140834900 GAGGGAAAGGGAAAGGGAAAGGG + Intergenic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963143266 3:141965559-141965581 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
963249272 3:143087607-143087629 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
963627410 3:147690674-147690696 GAAGGGAAGGGAAGGGAGGAGGG - Intergenic
963638712 3:147832886-147832908 GAGGGGAGGGGAAAGAAGGAAGG - Intergenic
963676376 3:148316531-148316553 TGGGCTAAGGGAAAGGTGGAGGG + Intergenic
964985414 3:162732336-162732358 GAGAGTCAGGGAAGGGTGGTGGG - Intergenic
965173146 3:165294103-165294125 GAGGGAGAGGGAAAGAAGGAAGG + Intergenic
966242905 3:177774703-177774725 GAGGGAGGGGGAAAGGAGGAAGG - Intergenic
966422266 3:179745276-179745298 AGGGGTAAGGGAAAGGGGGTGGG + Intronic
966461468 3:180181637-180181659 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966555206 3:181251370-181251392 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966954750 3:184864142-184864164 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
967033679 3:185631538-185631560 GAGGGTGGGGGAAAGGGGGAGGG - Exonic
967326969 3:188250915-188250937 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
968481112 4:833482-833504 GAGGGAGGGGGAAAGGAGGAAGG + Intergenic
968626192 4:1627737-1627759 GAGGGCAAGGGGGTGGTGGAGGG - Intronic
968857502 4:3138136-3138158 AAGGGAAAGGGAAAGGGAGAGGG - Intronic
968857509 4:3138155-3138177 AAGGGGAAGGGAAAAGGGGAAGG - Intronic
969088573 4:4675196-4675218 GTGGGTAATGGATAGGTAGATGG - Intergenic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969434675 4:7181585-7181607 TAGGGTAGGGGAAAAGTGGTTGG + Intergenic
969459405 4:7320872-7320894 GAGGGGAGGGGAAGGGAGGAAGG - Intronic
969465088 4:7351636-7351658 GAGAGGAAGGGATAGGAGGAGGG - Intronic
969496469 4:7529267-7529289 GAGGGTGAGGGAGGGGTGGTGGG - Intronic
969837697 4:9856958-9856980 GAGGGTGAGGGATGGGAGGAGGG + Intronic
970290115 4:14562769-14562791 GAAGAAAAGGGTAAGGTGGATGG + Intergenic
970298095 4:14652842-14652864 GAGGGAGAGGGAAAGGGAGAGGG + Intergenic
970572133 4:17393358-17393380 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
970645303 4:18113844-18113866 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
970920470 4:21388662-21388684 GAGTGTTGGGGAAAAGTGGAGGG - Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971063582 4:23001236-23001258 GAAAGAAAGGGAAAGGAGGAAGG + Intergenic
971254717 4:25003775-25003797 GCGGGTAAGGGAAAGGTAGAGGG + Exonic
971445493 4:26742065-26742087 GAGGGGAAGGGACATATGGAGGG + Intronic
971782666 4:31056572-31056594 GAGAGGAAGGGAAGGGAGGAAGG + Intronic
971849097 4:31960259-31960281 GAGAGAAAGAGAAAGGAGGAAGG - Intergenic
972568502 4:40289780-40289802 GGGGGTAAGGGAAAACAGGAAGG + Intergenic
972597416 4:40542286-40542308 GGGGGAAAGGGAAAGGGAGAGGG - Intronic
973081930 4:46003547-46003569 GAGGGTGAGGCAAAGCAGGATGG - Intergenic
973593237 4:52464104-52464126 GAGGGAAAGGGAGAGGGAGAGGG - Intergenic
973593239 4:52464110-52464132 GAGGGAGAGGGAAAGGGAGAGGG - Intergenic
973630180 4:52813044-52813066 GAGGCTAAGGGCATGCTGGATGG - Intergenic
973873180 4:55187281-55187303 GAGGGGAAGGGATAGGGAGAAGG + Intergenic
974214948 4:58832979-58833001 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
974281256 4:59797235-59797257 GACTTGAAGGGAAAGGTGGAAGG - Intergenic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
974597699 4:64036640-64036662 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
974640389 4:64623330-64623352 GAGGGTGAGGGATAGGTACAAGG - Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975360217 4:73460937-73460959 GAGGGGGAGGGGAAGGAGGAGGG - Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975600596 4:76095848-76095870 GAGGGTAAGGTGAAGGTGAGGGG - Intronic
975637235 4:76462712-76462734 GAGGGAAAGGGAGAGGGAGAGGG - Intronic
976037537 4:80842327-80842349 GATAGTAAGGAAAAGCTGGAGGG - Intronic
976096419 4:81513081-81513103 AAGAGGAAGGGAAAGGGGGAGGG - Intronic
976202863 4:82597223-82597245 GAGGGAAAGAGAAATTTGGAGGG - Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976561939 4:86511735-86511757 GAGCGAGAGGGAAAGGGGGAGGG + Intronic
976579701 4:86721701-86721723 GAGGGGGAGGGAGAGGGGGAGGG - Intronic
976598655 4:86917582-86917604 GAAGGGAAGGGAAAGAAGGAGGG + Intronic
976607225 4:86995272-86995294 GAGGGGGAGGGAGAGGGGGAGGG - Intronic
976753728 4:88477237-88477259 GAGGGGAGGGGAGAGGAGGAAGG + Intronic
976753750 4:88477277-88477299 GAAGGGAAGGGGAAGGGGGAGGG + Intronic
976753802 4:88477404-88477426 GAGGGGAAGGGGAAGGTGAAGGG + Intronic
976753830 4:88477481-88477503 GAGGGGAAGGAGAAGGTGAAGGG + Intronic
976778953 4:88737587-88737609 GAGGGAAAGGGAAAGGGGTTCGG - Intronic
977199076 4:94094205-94094227 GAGGGTAAAGGATGGGAGGAGGG - Intergenic
978313944 4:107415151-107415173 TAGGGTAAGGGGAAGGGGAAGGG + Intergenic
978598297 4:110402281-110402303 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
978665655 4:111178107-111178129 GAGGGGAAGGGAGAGGGGAAGGG - Intergenic
978980249 4:114936162-114936184 GAAGGTAAAGGAAAGGTAAAGGG + Intronic
979506482 4:121502809-121502831 GAGGGAAAGAGAAAGAGGGAGGG - Intergenic
979641828 4:123017183-123017205 GAGGGAAAGGGAGAGGGAGAGGG + Intronic
979641843 4:123017228-123017250 GAGGGAAAGGGAGAGGGAGAGGG + Intronic
979688484 4:123537689-123537711 GAGGGTAGGGGAGATGGGGAAGG - Intergenic
979690432 4:123553475-123553497 GAGGGTTAGGGTGAAGTGGAGGG - Intergenic
979732139 4:124037146-124037168 GATGGTAAGGTTAAGGTAGATGG - Intergenic
979977475 4:127214455-127214477 GAGGGTTAGGGAAAAAAGGAGGG + Intergenic
980019328 4:127689733-127689755 AAGGGGAAAGGAAAGGGGGAGGG + Intronic
980144651 4:128967002-128967024 GAGGGTAGGGGATGGGAGGAGGG - Intronic
980505130 4:133709276-133709298 GAAGGGAAGGGAAAGGAGGGAGG - Intergenic
980524759 4:133975330-133975352 GGGGGAAGGGGAAATGTGGAGGG + Intergenic
980812121 4:137895669-137895691 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
981086462 4:140689449-140689471 GAAGGGAAGGGAAGGGGGGAAGG - Intronic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981552846 4:145959347-145959369 GAGGCTAAGGAAAATCTGGAAGG - Intergenic
981624740 4:146742697-146742719 GAGGGAAGGGGAAGGGGGGAGGG - Intronic
982223142 4:153141676-153141698 GAAGGGAAGGGAAGGGAGGAGGG - Intergenic
982649785 4:158073190-158073212 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
982729835 4:158944237-158944259 GAGGGGAAGGCAAAGAGGGATGG - Intronic
982804738 4:159749258-159749280 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
982959169 4:161814102-161814124 AAGGGGAAGAGAAAGATGGAAGG + Intronic
983207656 4:164927609-164927631 TAGGGTAAGGGAAACATGAAAGG + Intergenic
983211133 4:164959308-164959330 TAGGGTAAGGGAAACATGAAAGG - Intronic
983401282 4:167269384-167269406 GCCGGTAAGGAAAAGGTGGTAGG - Intergenic
983403412 4:167294757-167294779 GAGAGTAAGGGAAGAGTTGATGG - Intergenic
983487988 4:168353832-168353854 CAGGGTAGGGGAAATGTGGATGG + Intergenic
983490730 4:168385990-168386012 GAGGGAGAGGGAAAGGGAGAAGG + Intronic
983581744 4:169316364-169316386 GAGGGGGAAGGAGAGGTGGAGGG - Intergenic
984291499 4:177800963-177800985 GATGGGAAGAGATAGGTGGAGGG - Intronic
984607653 4:181804027-181804049 GAGGGTAAGGGAAGGAGGAAGGG + Intergenic
984612368 4:181856007-181856029 GAAGGAAAGGGAAAGAAGGAAGG + Intergenic
984612376 4:181856045-181856067 GAAGGAAAGGGAAAGAAGGAAGG + Intergenic
984612385 4:181856087-181856109 GAAGGAAAGGGAAAGAAGGAAGG + Intergenic
984858944 4:184219841-184219863 AAGGGAAAGGGAAAGGGGAAGGG + Intronic
984858986 4:184219984-184220006 AAGGGTAAGGGGAAGGGGAAGGG + Intronic
984869821 4:184316187-184316209 GAGGGGAAGGGGAAGGGGAAAGG - Intergenic
984911224 4:184676356-184676378 GAAGGGAAGGGAAAGGAGAAGGG - Intronic
984942754 4:184948943-184948965 GAAGGAAAAGGAAAGGGGGAAGG + Intergenic
985190666 4:187369328-187369350 GAGGGTAAGGAAAAGGGGGTGGG + Intergenic
985213023 4:187615521-187615543 GAGAGGAAGGGAAAGGCAGAAGG + Intergenic
985396803 4:189553036-189553058 GAGGGCAGGGGAGAGGTGGGCGG + Intergenic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985756642 5:1723427-1723449 GAGGAAAAGAGAAAGGAGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986100309 5:4602402-4602424 GAGAGTAAGGGAAAGTTTGCAGG + Intergenic
986183625 5:5416971-5416993 GAGGGAGAGGGGAAGGAGGACGG + Intergenic
986240315 5:5954795-5954817 GAGGGAAGGGGAAGGGGGGAAGG - Intergenic
986240350 5:5954881-5954903 GAGGGAAGGAGAAGGGTGGAAGG - Intergenic
986240372 5:5954947-5954969 GAGGGAAGGAGAAGGGTGGAAGG - Intergenic
986240399 5:5955055-5955077 GAGGGAAAGGGAAGGAGGGAAGG - Intergenic
986362395 5:6993107-6993129 GAGGGCAAGGGGAAGGGGAAGGG - Intergenic
986437026 5:7744221-7744243 GAGGGTGGGGGAAAAGGGGAGGG + Intronic
986573681 5:9191123-9191145 GGAGGTAAGGGAAATGGGGAAGG + Intronic
986635428 5:9817871-9817893 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
986723444 5:10577074-10577096 AAGGGAAAGGGAAAGGGGAAAGG - Intronic
986723453 5:10577098-10577120 AAGGGGAAGGGAAAGGGGAAGGG - Intronic
986773801 5:10995972-10995994 GAGAGAAAGGGAAGGGAGGAAGG + Intronic
987195533 5:15522229-15522251 GAGGATAAGGAAAAGGGAGAAGG - Intronic
987288678 5:16487350-16487372 GAGTGTGAGAGAAAGCTGGAAGG - Intronic
987332546 5:16869913-16869935 GAAGGGAAGGGGAAGGGGGAGGG + Intronic
987807521 5:22788388-22788410 GAGGGTAAGGGTAAGGGGTAAGG + Intronic
988186493 5:27870926-27870948 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
988321179 5:29698460-29698482 GGGGGTAATGGAAAGGGGAAGGG + Intergenic
988615314 5:32769483-32769505 GAGAGAAAGGGAAATTTGGATGG - Intronic
988801215 5:34698192-34698214 GAGGGGAAGGGAGAGAGGGAGGG - Intronic
989000715 5:36757491-36757513 GAGGGTAGTGGAAAGGTGAGAGG - Intergenic
989110385 5:37901764-37901786 GAGGGCAAGGGAAGGGAGGAAGG + Intergenic
989141917 5:38209947-38209969 GAGGGAAAGAGAAAGGGAGAAGG - Intergenic
989211739 5:38863181-38863203 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
989750604 5:44888707-44888729 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
990107659 5:52284355-52284377 AAGGGAAAGGGAAAGACGGAGGG + Intergenic
990297930 5:54421380-54421402 GAGGGGGAGGGAGAGGGGGAGGG + Intergenic
990442983 5:55865405-55865427 GAGGGTGAGGGAGAGCTAGATGG - Intronic
990446183 5:55896578-55896600 GAGGGGAGGGGGAAGGTGGGGGG - Intronic
990506888 5:56454249-56454271 GAGCCTGAGGGAAATGTGGAAGG - Intergenic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
990842601 5:60100462-60100484 GAGAGGAAGGGAAAGCGGGAAGG + Intronic
991217607 5:64173615-64173637 AGGGGAAAGGGAAAGGAGGAGGG - Intronic
991328649 5:65466385-65466407 GACCCTAAGGGAAAGGAGGAAGG - Intronic
991373055 5:65939508-65939530 GAGGGAAAGGGAGAGGGAGAGGG - Intronic
991460134 5:66849413-66849435 GAGGGGAAAGGGGAGGTGGAGGG - Intronic
991510543 5:67371779-67371801 TAGGGGAAGGGAAAGAGGGATGG + Intergenic
991646662 5:68807949-68807971 AAGGGGAAGGGAAAAGGGGAAGG + Intergenic
991662885 5:68968442-68968464 GAAGGGAAGGGAAAGGGGAAGGG + Intergenic
991716076 5:69452064-69452086 GAAGGTAAGGGAAAGAAGGAAGG + Intergenic
992290630 5:75275898-75275920 GAGGGTGGGGTAAATGTGGAGGG - Intergenic
992489571 5:77229044-77229066 GAGGGAAAGGAAAGGATGGAAGG + Intronic
992574289 5:78096012-78096034 GAGGGAGAGGGAAAGGGAGAGGG - Intronic
992578980 5:78151847-78151869 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
992579074 5:78152036-78152058 GAAGGGAAGGGGAAGGGGGAGGG - Intronic
992977836 5:82138871-82138893 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
993315199 5:86395255-86395277 TGGGGTAGGGGAAAGGGGGAGGG + Intergenic
993835597 5:92816199-92816221 GGGGGTCAGGGAGAGTTGGAAGG + Intergenic
993901154 5:93584928-93584950 GAGGGGAAGGGGAAGGGGAAGGG - Exonic
993904957 5:93612319-93612341 GGGGGTAAGGGGAAAGGGGAGGG + Intergenic
994154390 5:96486603-96486625 GAGGGTAGGAGACAGCTGGAGGG - Intergenic
994609202 5:102014567-102014589 GAGGGAAAGGGAAAAGGGAAGGG + Intergenic
994940748 5:106320788-106320810 GAGGGAAAGGCAAAGAAGGAGGG + Intergenic
995002310 5:107148869-107148891 GAGGGGAAAGGAAAGGAAGAAGG + Intergenic
995052131 5:107719115-107719137 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
995153478 5:108880229-108880251 GAGAATAAGGGAAATGTGCAGGG + Intronic
995154824 5:108898547-108898569 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
995162058 5:108993659-108993681 GAGGGTGAGGGAGAGGGAGAGGG + Intronic
995299007 5:110556336-110556358 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
995306028 5:110651454-110651476 AAGGGAAAGGGAAAGAGGGAAGG + Intronic
995324535 5:110875382-110875404 GAAGGGAAGGGAAAGGAGGGAGG - Intergenic
995575043 5:113520904-113520926 GAGGGTAAAGGATGGGAGGAGGG - Intronic
995882448 5:116858269-116858291 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
996057545 5:118998469-118998491 GGGGGAAAGGGAAAGGGAGAGGG - Intergenic
996159712 5:120147366-120147388 GAGGGTGAGGGAGAGGGTGAGGG - Intergenic
996189494 5:120521812-120521834 TGGGGTAAGGGAAAGGGGGAGGG - Intronic
996343680 5:122467007-122467029 GAGAGTAAGGGAGAGAAGGAAGG - Intergenic
996460760 5:123739645-123739667 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
997083743 5:130771734-130771756 CAGGGTATGGGAAAGGTAGTGGG + Intergenic
997180090 5:131819416-131819438 GAGGGGGAGGGAGAGGGGGAGGG + Intronic
997180094 5:131819428-131819450 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997301123 5:132806208-132806230 GAGGGTGGGGGACAGGGGGAGGG + Intronic
997517180 5:134498619-134498641 GAGGGTGAGGCCAAGGTGGGTGG + Intergenic
997567701 5:134902314-134902336 GAGGGAAAGTGAAAAGGGGAAGG + Intergenic
998484086 5:142486597-142486619 GAGGAGGAGGGAAAGGAGGAAGG - Intergenic
998491654 5:142551962-142551984 GAGGGGAGGGGAAAGGGGGTGGG - Intergenic
998879213 5:146629815-146629837 GAGGGCAAGGGAGAGGGAGAGGG - Intronic
998968469 5:147566083-147566105 GAGGGAAAGAGAATGGTGAATGG + Intergenic
999070087 5:148735593-148735615 GAAGGAAAGGGAAATGTGGATGG - Intergenic
999073588 5:148773670-148773692 GTGGATAAGAGAAGGGTGGAGGG + Intergenic
999189114 5:149733080-149733102 GAGGGTCAGGGAAAGTTTGGGGG - Intronic
999217627 5:149948574-149948596 GGTGGTAAGGGACAGGTGGAGGG - Intergenic
999236205 5:150097299-150097321 AAGGGAAAGGGAAAGGGGAAGGG + Intronic
999682108 5:154070148-154070170 GAGGGCAAGGAATAGGTGCAAGG - Intronic
999871975 5:155761808-155761830 GAAGGTGATGGAAAGGTTGATGG - Intergenic
1000199908 5:158997970-158997992 GAGGGGAAGGAAATGGTGGCAGG - Intronic
1000629388 5:163574362-163574384 GAAGGAAAGGGAAGGGAGGAAGG - Intergenic
1000841053 5:166219072-166219094 CAGGGAGAGAGAAAGGTGGAAGG + Intergenic
1001078091 5:168644435-168644457 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1001078101 5:168644465-168644487 GAGGGTGAGGGACAGGGAGAGGG + Intergenic
1001108496 5:168875791-168875813 AAGGGAAAGAGAAGGGTGGAGGG + Intronic
1001123403 5:168997995-168998017 GAGGGAAGGGGAGAGATGGAGGG - Intronic
1001268291 5:170291156-170291178 GAGGACAAGGGAAGGGAGGAAGG + Intronic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001402794 5:171455924-171455946 GAGGGTGGGGGAAAGATGCAGGG + Intronic
1001565153 5:172695303-172695325 GAGGGGGAGGGAAAGGAGGAAGG + Intergenic
1001806393 5:174590394-174590416 GCTGGAAAGGGAAAGGTGGTGGG + Intergenic
1001847871 5:174937662-174937684 GAGGTTAAGGGCAATGTGCAAGG + Intergenic
1002020421 5:176361130-176361152 CAGGGAAAGGGAAAGGGGAAGGG - Intronic
1002465542 5:179406473-179406495 GAGGGCGGGGGACAGGTGGAGGG - Intergenic
1002466799 5:179412325-179412347 GTCGGTGGGGGAAAGGTGGAAGG - Intergenic
1002719298 5:181247915-181247937 GAGGCTGAGGGAAAGGTGCGTGG + Intronic
1002904750 6:1439056-1439078 GCGGGAAAGGTAAAGGTGGAGGG - Intergenic
1003059673 6:2853443-2853465 GAGGGTCAGGGAAAGGCGAGGGG - Intergenic
1003059682 6:2853475-2853497 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003059719 6:2853566-2853588 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003059733 6:2853598-2853620 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003061363 6:2865309-2865331 GAGGGGAAGGGAAGCGGGGAGGG - Intergenic
1003312675 6:4983269-4983291 GAGAGTCATGGAAAGGTGGCTGG - Intergenic
1003832118 6:10022989-10023011 GAGGGGAAGGCAGAGGTGGTGGG - Intronic
1004114029 6:12749541-12749563 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
1004128562 6:12897855-12897877 GAGGGTGAGGGAATAGGGGAGGG - Intronic
1004152295 6:13133229-13133251 GAGGGAAAGGGAGAGGGAGAGGG - Intronic
1004152297 6:13133235-13133257 GAGGGAGAGGGAAAGGGAGAGGG - Intronic
1004293253 6:14387424-14387446 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1004620059 6:17324125-17324147 GAGTGTAAGGGAATGGTGTAAGG + Intergenic
1004622692 6:17344824-17344846 GATGGCAAGGGAAAGGGGGTTGG + Intergenic
1004874165 6:19938665-19938687 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1004880566 6:20003222-20003244 GAGGGAACTGGAAAGGAGGAAGG + Intergenic
1005018776 6:21398425-21398447 GAGGGGAAGGGACAGAGGGAGGG - Intergenic
1005319818 6:24642099-24642121 GAAGGGAAGGGAAAGAAGGAAGG + Intronic
1005341867 6:24850820-24850842 GAGAGTAAGGGAGAAGCGGAGGG - Intronic
1005710697 6:28501532-28501554 GAGGGGGAGGGGGAGGTGGAGGG - Intergenic
1005821527 6:29603488-29603510 GAGGGAAAGGGAGAGGGGAAGGG - Exonic
1005822541 6:29609401-29609423 GAGGGGAAGGGAAAAGAGAAGGG + Intronic
1005939077 6:30547315-30547337 GTGGGTAAGGGAAAGAGAGAAGG - Intronic
1006173392 6:32108159-32108181 CAGGGTCAGGGAAAAGAGGAGGG + Intronic
1006217658 6:32459136-32459158 GAGGGTGAAGGATAGGAGGAGGG + Intergenic
1006225196 6:32531545-32531567 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1006333224 6:33406668-33406690 GAGTGAAAGGGACAGATGGAAGG + Intronic
1006522288 6:34578014-34578036 GAGTGTACAGGAAGGGTGGAGGG + Intergenic
1006546441 6:34785693-34785715 GAGGGTGAGGGAGAGGGAGAGGG - Intergenic
1006567608 6:34973841-34973863 GAGGGCAAGGGGAAGGGGAAGGG - Intronic
1006567750 6:34974177-34974199 GAAGGGAAGGGGAAGGGGGAAGG - Intronic
1006729401 6:36225130-36225152 GAGGGAAAAGGAAGGGTGGAGGG + Intronic
1007107275 6:39292467-39292489 GAAGGAAAGGGAAAGGTAAATGG - Intergenic
1007279133 6:40697423-40697445 GAGGGTGTAGGGAAGGTGGAAGG + Intergenic
1007345623 6:41227796-41227818 GCTGGTCAGGGAAAGTTGGAGGG - Intergenic
1007608431 6:43132705-43132727 GAAGGTCAAGGAGAGGTGGAGGG + Intronic
1007635473 6:43297532-43297554 GAGGGGTAGGGAATGGGGGAGGG - Intronic
1007950267 6:45866005-45866027 GAAGGGAAGGGAAAGGAGAAAGG - Intergenic
1008106488 6:47444686-47444708 GAGGGAGAGGGAAAGGGAGAGGG + Intergenic
1008502891 6:52200829-52200851 GAGGGAAAAGGAAAGGGGAAGGG + Intergenic
1008652457 6:53577081-53577103 GAGGGGAAGGAATGGGTGGATGG - Intronic
1008698299 6:54068104-54068126 GAGGGAAAGGGAGAGGAGGGAGG - Intronic
1008785025 6:55158152-55158174 GAGGGTGAGCCAAAGCTGGATGG + Intronic
1008849590 6:56009038-56009060 GAGGATAAGGGAAAGGGTAAGGG - Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009929275 6:70157008-70157030 AAAAGTAAGGGAAAGGAGGAAGG + Intronic
1010015979 6:71105299-71105321 AAGCTTAAGGGAAATGTGGAGGG - Intergenic
1010400778 6:75442748-75442770 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
1010507244 6:76675615-76675637 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1010887421 6:81261880-81261902 GAGGGGAAGAGGAAGGGGGAGGG + Intergenic
1010899425 6:81407914-81407936 GAGGCTAAGTGAAATTTGGAAGG - Intergenic
1011216137 6:85007827-85007849 GAGGGTAGGGAAAAGGTGAAGGG + Intergenic
1012029834 6:94044886-94044908 GAGGGTAGGGGAATGGAGGAGGG + Intergenic
1012427637 6:99131762-99131784 GAGGGCAGAGGAAGGGTGGATGG - Intergenic
1012526461 6:100183738-100183760 GAGGGAAAGGCAGAGGGGGAGGG - Intergenic
1012526465 6:100183744-100183766 GAGGGAGAGGGAAAGGCAGAGGG - Intergenic
1012734169 6:102917976-102917998 GAGGGAAAGAGAAAGAGGGAGGG - Intergenic
1012734198 6:102918078-102918100 GAGGGAAAGAGAAAGAGGGAGGG - Intergenic
1012872811 6:104692040-104692062 GAAGGGAAGGGAAGGGGGGAAGG + Intergenic
1013231957 6:108167806-108167828 GAGGGCGAGTGAAAGGGGGAGGG - Intronic
1013300708 6:108802720-108802742 GAGGGAAAGGGAATGCTGGGTGG + Intergenic
1013309584 6:108880751-108880773 GAAGGGAACGGAAAGGGGGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013608515 6:111773324-111773346 GAGGGAGAGGGAAAGGGAGAGGG + Intronic
1013608517 6:111773330-111773352 GAGGGAAAGGGAGAGGGAGAGGG + Intronic
1013608521 6:111773342-111773364 GAGGGAGAGGGAAAGGGAGAGGG + Intronic
1013608595 6:111773560-111773582 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
1013681498 6:112529201-112529223 GAGGGAGAGGGAAAGGGAGAGGG + Intergenic
1013681500 6:112529207-112529229 GAGGGAAAGGGAGAGGGAGAGGG + Intergenic
1014684352 6:124477666-124477688 GAGGGGAGGGGAAAGGAGAAGGG - Intronic
1014799474 6:125761923-125761945 GTGGGTAATGAAAAGGTCGAGGG + Intergenic
1014806322 6:125833600-125833622 GAGGGGGAGGGACAGGGGGAGGG + Intronic
1015113404 6:129619371-129619393 AAGGGGGAGGGAAAGGGGGAGGG + Intronic
1015113410 6:129619383-129619405 AAGGGGGAGGGAAAGGGGGAGGG + Intronic
1015898753 6:138042694-138042716 GAGGGTAGAGGATAGGAGGAGGG + Intergenic
1016414407 6:143817849-143817871 GAGGGTAGGGGAAAGGAGATAGG + Intronic
1016449088 6:144162673-144162695 TAGGGGATGGGAAAGGTTGAGGG + Intronic
1016582770 6:145647689-145647711 AAGGGAAAGGGAAAGGGGAAGGG + Intronic
1016647058 6:146422954-146422976 GAGGGAAAGGGAGAGGAGGGAGG + Intronic
1016684684 6:146867896-146867918 GAGGGTGAGGGATGGGCGGAGGG - Intergenic
1016752244 6:147643719-147643741 GAGGGAAAGAGAAAGAGGGAAGG + Intronic
1016779707 6:147944104-147944126 GAGGGGGAGGGAAAATTGGATGG - Intergenic
1016830107 6:148425710-148425732 GAGGGGAAGGGAGAGGGGGATGG - Intronic
1017036283 6:150270069-150270091 GAGGGGGAGGGGAAGCTGGATGG + Intergenic
1017038612 6:150289417-150289439 GAGGGTGAGGGAAGAGGGGAGGG + Intergenic
1017142533 6:151204744-151204766 AAAGGTAAGAGAAAGGAGGAGGG - Intergenic
1017259703 6:152371747-152371769 GAGGGGAAGGGAAGGGGGAAGGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017658758 6:156654033-156654055 GAGGATGAGGGAAAGGTGACTGG - Intergenic
1017800574 6:157892109-157892131 GAAGAGGAGGGAAAGGTGGAAGG + Intronic
1017822517 6:158059927-158059949 GAGGGTAAGGGACACATGGCTGG - Intronic
1017890222 6:158631646-158631668 GGGGGTCAGGGAGAGGAGGACGG + Intronic
1019159077 6:170057617-170057639 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019159101 6:170057664-170057686 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019313468 7:373972-373994 GAGGGAAAGGGAAGGAGGGAGGG + Intergenic
1019404842 7:877753-877775 GGGGCCAAGGGAGAGGTGGAGGG - Intronic
1019410706 7:905362-905384 AAGGGAAAGGGAAAGGAGAAAGG + Intronic
1019491548 7:1316137-1316159 GAGGGTAAGGGGCAGGTTGGGGG + Intergenic
1019551774 7:1606761-1606783 GAGGGACAGGGAGAGGAGGAAGG - Intergenic
1019668834 7:2267324-2267346 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
1019715192 7:2535309-2535331 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1020369585 7:7417483-7417505 GAAGGTAAGGGAAGGAGGGAGGG + Intronic
1020735309 7:11941856-11941878 GAAGGGAAGGGAAAGGAGAAAGG - Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021677028 7:23090657-23090679 GAGGGGATGGGGAACGTGGATGG - Intergenic
1022070447 7:26908512-26908534 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022126136 7:27359428-27359450 GAGGGTGAGGAAGAGGAGGAGGG + Intergenic
1022194235 7:28049012-28049034 GAGGGGAAGGGAAGGGAGGGAGG - Intronic
1022357049 7:29625780-29625802 GAGGGAAAGGGGAAGGAGAAGGG + Intergenic
1022358994 7:29641640-29641662 AAGGGTTAGGGACAGTTGGATGG + Intergenic
1022592898 7:31682987-31683009 GAGGGTAAAGGGAAGGGGCATGG + Intergenic
1022773302 7:33497807-33497829 GAGGGTCAGGGTACGGTGCAGGG + Intronic
1023165288 7:37337376-37337398 TGGGGTAAGGGAAGGGGGGAGGG + Intronic
1023609461 7:41958568-41958590 GAGGGGAAGGGAAGGGAGGGTGG - Intergenic
1023705015 7:42932227-42932249 GAGAGTAAAGGAAAGGTGAGGGG - Exonic
1023866260 7:44239686-44239708 GAGGGGAAGGGAGGGGTGGGCGG + Intronic
1023911138 7:44557668-44557690 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
1023917019 7:44597121-44597143 GAGAGTGAGGGAAGGGAGGAGGG + Intergenic
1024459199 7:49642720-49642742 TGGGGTAAGGGACAGGGGGAGGG + Intergenic
1024538507 7:50458912-50458934 GAGGGAAAGGGAGAGGGAGAGGG - Intronic
1024538509 7:50458918-50458940 GAGGGAGAGGGAAAGGGAGAGGG - Intronic
1024581254 7:50802733-50802755 GAGGGAAAGGGAAAGGGAAAGGG + Intergenic
1024737775 7:52323615-52323637 GAAGGGAAGGGAAAGGGGAAGGG - Intergenic
1024737782 7:52323632-52323654 AAGGGAAAGGGAAAGGGGAAGGG - Intergenic
1025108988 7:56196896-56196918 GAGGGGAAGGGAAAGGGGGAGGG - Intergenic
1025117186 7:56268405-56268427 GAGGGAAAGAGAAAGAGGGAGGG - Intergenic
1025803842 7:64810441-64810463 GAGGGAGAGGGAGAGGGGGAGGG + Intronic
1026308755 7:69166120-69166142 GAGGGGAAGGGAAGAGGGGAAGG + Intergenic
1026517176 7:71082911-71082933 GAGAGGAGGGGAGAGGTGGAGGG - Intergenic
1026526920 7:71162016-71162038 GAGGGAAAGAGAAAGAAGGAAGG - Intronic
1026736302 7:72950844-72950866 AAGAGTAAGGGAAAGGGAGAGGG + Exonic
1026762531 7:73137691-73137713 GAGGGGAAGGGAAAGGGAGGGGG + Intergenic
1026762540 7:73137707-73137729 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1027038994 7:74947467-74947489 GAGGGGAAGGGAAAGGGAGGGGG + Intergenic
1027039003 7:74947483-74947505 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1027084684 7:75254993-75255015 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1027084693 7:75255009-75255031 GAGGGGAAGGGAAAGGGAGGGGG - Intergenic
1027107431 7:75414218-75414240 AAGAGTAAGGGAAAGGGAGAGGG - Intergenic
1027253496 7:76414664-76414686 GAGGGGAAGGGGAAGGGGAAAGG - Intronic
1027951513 7:84822807-84822829 CAGGTTATGGGAAGGGTGGAGGG - Intergenic
1028654463 7:93187674-93187696 GAAAGAAAGGGAGAGGTGGATGG + Intergenic
1028655975 7:93207463-93207485 GAGGGAAAGGGAAGGGGAGAGGG + Intronic
1028757617 7:94455965-94455987 AAGGGTAAGGGAAAGGGAAAGGG + Intergenic
1028854066 7:95569709-95569731 GACGGTGGGGGAAAAGTGGATGG - Intergenic
1029111927 7:98217101-98217123 GAGGGGAAGGGAAGGGTGGGAGG + Exonic
1029552506 7:101244918-101244940 GAGGGAAAGGGAAGGTCGGAGGG - Intronic
1029577595 7:101413675-101413697 GAAGGGAAGGGAAATGAGGAAGG + Intronic
1029687187 7:102156971-102156993 GAGGGTCTGGGAAGGGTGGATGG + Intronic
1029795855 7:102893830-102893852 AAGGGGAAGGGAAAGGCGAAGGG + Intronic
1030126264 7:106155386-106155408 AAGGGAAAGGAAAAGATGGAGGG - Intergenic
1030288089 7:107847451-107847473 GAGGGAAAGGGAGAGGGAGAGGG - Intergenic
1030288091 7:107847457-107847479 GAGGGGGAGGGAAAGGGAGAGGG - Intergenic
1030288101 7:107847479-107847501 GAGGGGGAGGGAAAGGGAGAGGG - Intergenic
1030379945 7:108800668-108800690 GAGAGTAGAGGAGAGGTGGAGGG - Intergenic
1030379982 7:108800777-108800799 GAGGGGAGGGGACAGGAGGAGGG - Intergenic
1030725527 7:112921939-112921961 GAGGGAGAGGGAGAGGGGGAGGG - Intronic
1031414503 7:121479405-121479427 GAGGGAGAGGGAAAGGGAGAGGG + Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031874593 7:127123872-127123894 AAGGGAAAGGGAAAGGAAGAAGG - Intronic
1031915621 7:127560185-127560207 GAGGGAAAGTGGAAGGTGGAAGG - Intergenic
1031955402 7:127937470-127937492 GAGGAGAAGGGACAGGGGGAGGG - Intronic
1031977231 7:128101784-128101806 AAGGGTGTGGGAAAGGGGGATGG + Intergenic
1032179713 7:129664160-129664182 GAGGGTAGGGGAGAGGGAGAGGG + Intronic
1032527327 7:132588666-132588688 GAAGGGAAGGGAAGGGAGGAGGG + Intronic
1032625381 7:133586228-133586250 GAGGGTGGAGGAAAGGAGGAAGG - Intronic
1033158896 7:138980172-138980194 GGCGGAAAAGGAAAGGTGGAAGG - Intronic
1033174489 7:139111958-139111980 GAGGGAAAGGGAAAGGGAAACGG + Intergenic
1033215108 7:139487686-139487708 GAGGTGAAGGGGAAGGGGGAGGG + Intergenic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033718933 7:144036206-144036228 GAGAGCAAGGTAAAGATGGAGGG - Intergenic
1034004375 7:147452957-147452979 GAGGGGGAAGGAAAGGAGGAAGG + Intronic
1034244838 7:149636405-149636427 GAGGGTGAGGGTGGGGTGGATGG - Intergenic
1034391593 7:150791715-150791737 GAGGGAAAGGAAAAGGTGACAGG + Intronic
1034452222 7:151143135-151143157 GTGGGTAATGGAAAGGGGGGTGG - Intronic
1034606362 7:152319818-152319840 GAGGGAAAGGGAGAGGGAGAGGG - Intronic
1034606811 7:152323782-152323804 GAGGGGAAGGGAAGGGAGGCAGG + Intronic
1034625186 7:152487250-152487272 GAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1034625197 7:152487273-152487295 GAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1034625208 7:152487296-152487318 GAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1034625219 7:152487319-152487341 GAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1034625230 7:152487342-152487364 GAGGGAAAGGGAAAGGGGAAGGG - Intergenic
1034866305 7:154645443-154645465 GAGGGGAAGGGAGAAGGGGAGGG - Intronic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035856958 8:2985966-2985988 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1035909952 8:3555186-3555208 GAGGTGTAGGGAAAGATGGACGG + Intronic
1035992787 8:4510847-4510869 GAAGGGAAGGGAAGGGAGGAGGG - Intronic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1037162593 8:15791058-15791080 CAGGGTAATGGAAATGGGGATGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037702439 8:21287341-21287363 GAGGGTAAGAGAGAGGAAGAGGG - Intergenic
1037753242 8:21696107-21696129 GAGGGGACAGGAAAGGAGGAGGG - Intronic
1037756451 8:21713058-21713080 GAGGGAAAGGGAGAGGGAGAGGG + Intronic
1038166305 8:25088068-25088090 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1038398541 8:27265507-27265529 GAGGGAAAGAGAAAGGGAGAGGG - Intergenic
1038493322 8:27985200-27985222 AAGAGTCAGGGAAAGGGGGATGG + Intronic
1038675104 8:29616162-29616184 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
1038860932 8:31388088-31388110 GAGGGGAAGGGAAAGGAAGAGGG - Intergenic
1038860938 8:31388106-31388128 GAGAGGAAGGGAAAGGAAGAGGG - Intergenic
1038990077 8:32858384-32858406 GAGACTAAGGGATAGGTTGATGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039488014 8:37927069-37927091 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1039564675 8:38542512-38542534 GAGGGGAATGGAGAGGGGGAGGG - Intergenic
1039658799 8:39439550-39439572 GAGGGGAGGGGAGAGGGGGAGGG - Intergenic
1040858026 8:51970368-51970390 GGGGGTAAGGGACAGGGGGCAGG - Intergenic
1041021719 8:53644893-53644915 GAGGGAGAGGGAAAGGCGGGGGG - Intergenic
1041284832 8:56249545-56249567 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1041712778 8:60909122-60909144 GTGGGTAAAGGAAATGTGGGGGG - Intergenic
1041753875 8:61291672-61291694 GAGAGGGAGGGAAAGGAGGAGGG - Intronic
1041790953 8:61695575-61695597 GAGAGTAAGGGAAGTGAGGAAGG - Intronic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1042375373 8:68045411-68045433 GAAGGTATGTGAGAGGTGGAGGG - Intronic
1042442513 8:68844767-68844789 CAGGTTATGGGAACGGTGGAGGG - Intergenic
1042466188 8:69132249-69132271 GAGGGTGGGGGAAAGGGGGAGGG + Intergenic
1042480547 8:69297563-69297585 GAGGGAAAGGGAAAGGGAAACGG + Intergenic
1043431800 8:80202085-80202107 GAGGGGAGGGGAGAAGTGGAGGG + Intronic
1043772514 8:84223161-84223183 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1043938281 8:86167967-86167989 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1043958723 8:86390712-86390734 GAGGGGGAGGGAGAGGGGGAGGG + Intronic
1043981550 8:86646966-86646988 GATGGCAAGGGAAAGCAGGAAGG - Intronic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1044597372 8:93971418-93971440 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1044778181 8:95715597-95715619 GGAGGTAAGGGAAAGGAAGAAGG - Intergenic
1044983227 8:97736341-97736363 GAGGGTGAAGGGAAGGGGGAGGG + Intergenic
1045359804 8:101422434-101422456 GAGTGAAAGGGAAAGAAGGATGG + Intergenic
1045399706 8:101801011-101801033 GAAGGAAAGGGAAAGGATGAAGG + Intronic
1045922190 8:107544366-107544388 GAGGGGAGGGGAAAGATGAATGG + Intergenic
1046046974 8:108976133-108976155 GAGGGGAGGGGAAGGGAGGAGGG - Intergenic
1046126076 8:109910232-109910254 AAGGGAAAGGGAAAGGGGAAGGG - Intergenic
1046592210 8:116220442-116220464 GAGGGAAAGGGAAAGAGGGAAGG - Intergenic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1046703435 8:117426170-117426192 GAGGGAGAGGGAGAGGTTGAGGG - Intergenic
1046735909 8:117777100-117777122 GAGGGAGAGGGAAAGGGAGAGGG - Intergenic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1047317563 8:123748255-123748277 GAGGGGAGGGGAGAGGAGGAGGG + Intergenic
1047317571 8:123748273-123748295 GAGGGGAGGGGAGAGGAGGAGGG + Intergenic
1047317579 8:123748291-123748313 GAGGGGAGGGGAGAGGAGGAGGG + Intergenic
1047531563 8:125681617-125681639 GAGGGTAAGGTAAAAGTCAATGG + Intergenic
1047597781 8:126395997-126396019 GACTGTAAGGGAGAGGTGAATGG - Intergenic
1047701395 8:127452702-127452724 AAGGGGAAGGGAGAGGGGGAAGG + Intergenic
1047895459 8:129361618-129361640 GAGAGAAAGAGAAAGGAGGAAGG - Intergenic
1047907006 8:129483142-129483164 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1048008833 8:130440662-130440684 GAGTGTAAGGGAGAGATGGGGGG - Intronic
1048383109 8:133885753-133885775 GAGAGAAAGAGAAAGGAGGAGGG + Intergenic
1048837878 8:138538348-138538370 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1048837888 8:138538387-138538409 GAAGGGAAGGGAAAGGAAGAAGG + Intergenic
1049478888 8:142810630-142810652 GAGAGAAAGGGAAGGATGGAAGG - Intergenic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050125451 9:2352607-2352629 GTGGGTAAGGGAAAAGGGGGAGG + Intergenic
1050315595 9:4397781-4397803 GAGGGGAGGGGAGAGGAGGAAGG + Intergenic
1051166408 9:14266720-14266742 GAGGGTAAGGGAGAGGGAGGAGG - Intronic
1052077281 9:24158822-24158844 GAGGGAGAGAGAAAGGAGGAAGG - Intergenic
1052370869 9:27663179-27663201 AATGGCAAGGGAAAGGAGGATGG - Intergenic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1052951856 9:34219822-34219844 GAGGGGAAGGGGAAGGGAGAGGG - Intronic
1052960246 9:34289498-34289520 GAGGGAATGGGGGAGGTGGAAGG - Intronic
1053330896 9:37206294-37206316 GAGGGAGAGGGAGAGGGGGAAGG - Intronic
1053442056 9:38124856-38124878 GAGGGGCAGAGAGAGGTGGAGGG - Intergenic
1053532416 9:38895769-38895791 GGGGGTAAGGGAAAAAGGGAGGG - Intergenic
1053536682 9:38933471-38933493 GGGGGTAAGGGAAAAAGGGAGGG - Intergenic
1054204641 9:62120190-62120212 GGGGGTAAGGGAAAAAGGGAGGG - Intergenic
1054336912 9:63815971-63815993 TAGGGAAAGGGAAAGGGTGAGGG - Intergenic
1054359525 9:64100266-64100288 GAGGGAGAGGGAGAGGAGGAGGG - Intergenic
1054629451 9:67430459-67430481 GGGGGTAAGGGAAAAAGGGAGGG + Intergenic
1054633718 9:67468168-67468190 GGGGGTAAGGGAAAAAGGGAGGG + Intergenic
1054725420 9:68645459-68645481 GAGGATATGGGAAAGGTGGGAGG - Intergenic
1054947831 9:70814883-70814905 GAGGGGGAGGGAAAGAGGGAGGG - Intronic
1055087723 9:72331339-72331361 TAGGGTAAGGGAAAGAATGAAGG - Intergenic
1055400308 9:75916691-75916713 GAGGGTTAGGGAGAGGTGTTAGG + Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055630732 9:78220774-78220796 GAGAGTAAGGGAAAGATTGATGG - Intergenic
1055707386 9:79020490-79020512 GAGGGGAAAGAAAAAGTGGAGGG + Intergenic
1056524800 9:87433103-87433125 GAGGGGAAGGGAGGGGAGGAGGG + Intergenic
1056617231 9:88179014-88179036 AAGGTTAAGGGAAAGGAGGGAGG + Intergenic
1057275782 9:93675408-93675430 GCGGGTGAGGGTAATGTGGAAGG - Intronic
1057291021 9:93807631-93807653 GAGGGGAAGGGACAGCTGGCAGG - Intergenic
1057303574 9:93900020-93900042 GAGGGGAAGGGAAGGGAGTAGGG - Intergenic
1057458541 9:95237425-95237447 GAGGTTTAGTGAGAGGTGGAGGG - Intronic
1057739364 9:97698388-97698410 GAGGGGAAGGGAGATGGGGATGG - Intergenic
1058074165 9:100634033-100634055 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1058368481 9:104236096-104236118 GAGAGGGAGGGAGAGGTGGAGGG + Intergenic
1058541779 9:106019273-106019295 GAGGGAGAGGGAAAGAGGGAGGG + Intergenic
1058732184 9:107861110-107861132 GAGGGTTGGGGAAGGGTGGGAGG - Intergenic
1058817564 9:108699042-108699064 AAGGGGAAGGGAAAGGGGGATGG + Intergenic
1059350140 9:113658573-113658595 GAGAGGAAGGGAAAGAAGGAGGG + Intergenic
1059410614 9:114130009-114130031 GAGGGAGAGGAAAAGGTGGTGGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059903042 9:118950239-118950261 GAGAGAAATGGAAAGGAGGAAGG + Intergenic
1059949287 9:119445234-119445256 GAGGGGAGGGGAGAGGGGGAGGG - Intergenic
1060069929 9:120537363-120537385 GAGGGCAAGGGCAGGGAGGAGGG - Intronic
1060735725 9:126065530-126065552 GAGGGGGAGGGAAAGGAGGAAGG - Intergenic
1060830921 9:126715657-126715679 GAAGGTAAGGGAAGGGAGGAAGG + Intergenic
1061360411 9:130138436-130138458 GAGGGGATGGGGAAGGGGGAAGG - Exonic
1061360433 9:130138486-130138508 GAGCGGAAGGGGAAGGGGGAGGG - Exonic
1061405073 9:130389145-130389167 GAGGGGCAGGGAGAGGTGGCTGG - Intronic
1061645688 9:131999219-131999241 CAGGGTAAGAGAGAGTTGGAAGG + Intronic
1061741629 9:132710840-132710862 GAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1061947171 9:133914798-133914820 GAGGGGAAGGGAGAAGGGGAGGG + Intronic
1061957859 9:133972964-133972986 GATGCTAAGGGAAGGGTGGGAGG + Intronic
1061967570 9:134025026-134025048 GAGGGGCTGGGAAAGGAGGAGGG - Intergenic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062248047 9:135579826-135579848 GGGGATAATGGAAGGGTGGATGG - Intergenic
1062248058 9:135579866-135579888 GGGGATAATGGAAGGGTGGATGG - Intergenic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1203464198 Un_GL000220v1:69374-69396 GAGGGTGAGGGAGAGGGAGAGGG + Intergenic
1203549748 Un_KI270743v1:157358-157380 GAGGTGAAGGAAATGGTGGAGGG - Intergenic
1203663922 Un_KI270754v1:8445-8467 GAGGGTAGGGGAGAGGTGGGCGG - Intergenic
1185499223 X:584636-584658 GAGGAGAAGGGAGAGGAGGAGGG + Intergenic
1185581452 X:1213404-1213426 GAGGGGAGGGGATAGGTGGAGGG - Intergenic
1185640520 X:1587861-1587883 GAGGGGAGGGGAAGGGGGGAGGG - Intergenic
1185640688 X:1588230-1588252 GAGGGGAAGGGAGGGGAGGAGGG - Intergenic
1185756648 X:2659163-2659185 AAAGGAAAGGGAAAGGGGGAGGG - Intergenic
1185867546 X:3637043-3637065 AAGGGAAAGGGAAGGGAGGAAGG + Intronic
1186047303 X:5550396-5550418 GAGGGAGAGGGAAAGGCAGAGGG - Intergenic
1186786698 X:12962566-12962588 GAGGGAAAGGGAGAGGGAGAGGG - Intergenic
1186854010 X:13608547-13608569 GAGAGTAAGGGAGAGGGAGAAGG - Intronic
1186928294 X:14359234-14359256 GAGGGCAAGGGAAAGGAGTTAGG - Intergenic
1187101878 X:16201415-16201437 CAGGGTAAGGTAAAGGTGAGGGG + Intergenic
1187135162 X:16540968-16540990 GAGAGAGAGGGAAAGGAGGAAGG + Intergenic
1187253464 X:17620866-17620888 GTGGGGAGGGGAAAAGTGGAGGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187672084 X:21677817-21677839 GAGGGTAGTGGAAAGATGGTGGG + Intergenic
1187948644 X:24450801-24450823 GGGAGGAAGGGAAAGGGGGAGGG + Intergenic
1188806427 X:34596281-34596303 GAGGGTAGGGGATGGGAGGAGGG - Intergenic
1189117022 X:38353386-38353408 GTGGGGAAGGGAAAGGGGAAGGG + Intronic
1189289146 X:39872967-39872989 GAGGGGAAGGGAGAGAAGGATGG - Intergenic
1189342091 X:40211791-40211813 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1189364995 X:40381200-40381222 CAGGGTATGGGAGAGGTGGAGGG - Intergenic
1189539880 X:41975046-41975068 GAGGGTAGAGGATAGGAGGAGGG + Intergenic
1190101024 X:47523389-47523411 GAGGGAAGAGGAAAGGAGGAGGG + Intergenic
1190203179 X:48381443-48381465 GAAGGGAAGGGAAAGGAGAAGGG - Intergenic
1190203194 X:48381485-48381507 GAAGGGAAGGGAAAGGAGAAGGG - Intergenic
1190207342 X:48413919-48413941 GAAGGGAAGGGAAAGGAGAAGGG + Intergenic
1190207357 X:48413961-48413983 GAAGGGAAGGGAAAGGAGAAGGG + Intergenic
1190287859 X:48972400-48972422 GAGGGTAAAGGGAATGTAGAGGG + Intergenic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190324768 X:49199836-49199858 GAGGGCAAGGGACAAGGGGAGGG - Intronic
1190505444 X:51120479-51120501 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1190534624 X:51413563-51413585 GAGAGGGAGGGAAAGATGGAGGG - Intergenic
1191226845 X:58053209-58053231 GAGGGAGAGGGAAAAGGGGAGGG - Intergenic
1191637179 X:63392388-63392410 GAGGGAGAGGGAGAGGTAGAGGG - Intergenic
1191676287 X:63795359-63795381 GAGGAGAAGGGAAAGAAGGAAGG + Intergenic
1191820665 X:65303212-65303234 GAGGGTAAAGGACGGGAGGAAGG + Intergenic
1191851121 X:65587221-65587243 AAGGGGAAGGGAAAGGGGGCGGG + Intergenic
1191915579 X:66198186-66198208 GAGGGAGAGGGAAAGGGAGAGGG - Intronic
1192194064 X:69016884-69016906 GAGGGTATGGGACAGCTGAAGGG + Intergenic
1192207872 X:69108141-69108163 GAGGGAAAGGGAGAGATGGCAGG - Intergenic
1192324653 X:70122417-70122439 GAGGGGAAGGGAGAGGGAGAGGG - Intergenic
1192361945 X:70445779-70445801 GGGGGTAAGGGCATGGCGGAGGG + Intronic
1192364185 X:70457298-70457320 GAGTGTAAGGGAAAGAAAGATGG + Intronic
1192456690 X:71282249-71282271 GAGGTTAAGGTTAAGGTGGGAGG - Intergenic
1192456858 X:71283386-71283408 GACGGGAAAGGAAAGGGGGAGGG - Intronic
1192500331 X:71645910-71645932 GAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1192813686 X:74569829-74569851 GAGGGAGAGGGAGAGGGGGACGG + Intergenic
1194420823 X:93670705-93670727 GAAAGGAAGGGAAAGGTAGAAGG - Intergenic
1195157767 X:102141177-102141199 GAGGGAAAGCGAAAGGCTGAGGG - Exonic
1195234922 X:102887828-102887850 AAGGGAAAGGGAAGGGAGGAAGG - Intergenic
1195234928 X:102887846-102887868 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1195234942 X:102887888-102887910 AAGGGAAAGGGAAAGGGGAAGGG - Intergenic
1195394247 X:104394023-104394045 GAGGGAAAGGGAAGAGTTGATGG + Intergenic
1195803670 X:108737965-108737987 GAGGGAGAGGGAAAGGGAGAAGG - Intergenic
1196193649 X:112818679-112818701 CGGGGTAAGGGAGAGTTGGAGGG + Intronic
1196293036 X:113966113-113966135 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1197116020 X:122834906-122834928 GAGGGGAAGAGAGAGGGGGAGGG - Intergenic
1197116034 X:122834941-122834963 GAGGGGAAGAGAGAGGGGGAGGG - Intergenic
1197130772 X:123003061-123003083 GAAGGGAAGGGAAAGGAGGTAGG + Intergenic
1197148298 X:123192490-123192512 CAAGGTAAGGGAAGGATGGAGGG - Intronic
1197455485 X:126673180-126673202 GAGGGAAAGGGAGAGGGAGAGGG - Intergenic
1197455487 X:126673186-126673208 GAGGGAGAGGGAAAGGGAGAGGG - Intergenic
1197871970 X:131069511-131069533 GAGGGTGGGGGAAAGAGGGAGGG - Intronic
1197904817 X:131413367-131413389 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1198133952 X:133728123-133728145 AAAGGCAAGGGAAAGGTGCAAGG + Intronic
1198438138 X:136636723-136636745 GAAGGTAGTGGAAAGGTGCATGG - Intergenic
1198476740 X:137001664-137001686 GAGGGAGAGGGAAAGGGAGAGGG + Intergenic
1198476742 X:137001670-137001692 GAGGGAAAGGGAGAGGGAGAGGG + Intergenic
1198580185 X:138055116-138055138 GAGGGTAGGGGATAAGTGGCTGG + Intergenic
1199470384 X:148189030-148189052 CAGGGTAACAGAAAGGTTGAAGG - Intergenic
1199484611 X:148334318-148334340 GAGGGCAAAGGAAACCTGGAAGG - Intergenic
1199742857 X:150751817-150751839 GAGGGTGAGGGAGGAGTGGAAGG - Intronic
1199812581 X:151365345-151365367 GAAGGGAAGGGAAAGGGGAAGGG - Intergenic
1200072342 X:153535468-153535490 GAGAGGGAGGGAAAGGGGGATGG - Intronic
1200123556 X:153802670-153802692 GAAGGGGAGGGAAAGGTGGGAGG - Exonic
1200795094 Y:7333531-7333553 GAGGGGAGGGGAGGGGTGGAAGG - Intergenic
1200842425 Y:7796431-7796453 GAGGGAAAGGGAAAGGGAAAGGG - Intergenic
1201183033 Y:11368054-11368076 GAAGGGAAGGGAAAGGAAGAAGG + Intergenic
1201398407 Y:13575016-13575038 GATGGTAAGGGAGTTGTGGAAGG + Intergenic
1201451153 Y:14116210-14116232 GAGGGGAGGGGAAAGAAGGAGGG + Intergenic
1201643200 Y:16200502-16200524 AAGGGTTAGGGACAGTTGGATGG - Intergenic
1201659615 Y:16384819-16384841 AAGGGTTAGGGACAGTTGGATGG + Intergenic
1201948143 Y:19535185-19535207 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1201948154 Y:19535203-19535225 GAGGGAGAGGGAGAGGGGGAGGG - Intergenic