ID: 1072722904

View in Genome Browser
Species Human (GRCh38)
Location 10:97791879-97791901
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072722904_1072722911 3 Left 1072722904 10:97791879-97791901 CCTTCCTGGTCTGAGGACTCCCA No data
Right 1072722911 10:97791905-97791927 GGGTTGTGTTCAGCAAAGACAGG No data
1072722904_1072722912 4 Left 1072722904 10:97791879-97791901 CCTTCCTGGTCTGAGGACTCCCA No data
Right 1072722912 10:97791906-97791928 GGTTGTGTTCAGCAAAGACAGGG No data
1072722904_1072722913 18 Left 1072722904 10:97791879-97791901 CCTTCCTGGTCTGAGGACTCCCA No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072722904 Original CRISPR TGGGAGTCCTCAGACCAGGA AGG (reversed) Intergenic