ID: 1072722908

View in Genome Browser
Species Human (GRCh38)
Location 10:97791898-97791920
Sequence TTGCTGAACACAACCCGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072722908_1072722917 27 Left 1072722908 10:97791898-97791920 CCCATCCGGGTTGTGTTCAGCAA No data
Right 1072722917 10:97791948-97791970 CTTTGCCAGCCCTGTAGGTAGGG No data
1072722908_1072722916 26 Left 1072722908 10:97791898-97791920 CCCATCCGGGTTGTGTTCAGCAA No data
Right 1072722916 10:97791947-97791969 GCTTTGCCAGCCCTGTAGGTAGG No data
1072722908_1072722915 22 Left 1072722908 10:97791898-97791920 CCCATCCGGGTTGTGTTCAGCAA No data
Right 1072722915 10:97791943-97791965 TGCTGCTTTGCCAGCCCTGTAGG No data
1072722908_1072722913 -1 Left 1072722908 10:97791898-97791920 CCCATCCGGGTTGTGTTCAGCAA No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072722908 Original CRISPR TTGCTGAACACAACCCGGAT GGG (reversed) Intergenic