ID: 1072722910

View in Genome Browser
Species Human (GRCh38)
Location 10:97791903-97791925
Sequence TGTCTTTGCTGAACACAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072722910_1072722913 -6 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722910_1072722915 17 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722915 10:97791943-97791965 TGCTGCTTTGCCAGCCCTGTAGG No data
1072722910_1072722919 28 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722919 10:97791954-97791976 CAGCCCTGTAGGTAGGGCTGAGG No data
1072722910_1072722917 22 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722917 10:97791948-97791970 CTTTGCCAGCCCTGTAGGTAGGG No data
1072722910_1072722916 21 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722916 10:97791947-97791969 GCTTTGCCAGCCCTGTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072722910 Original CRISPR TGTCTTTGCTGAACACAACC CGG (reversed) Intergenic