ID: 1072722912

View in Genome Browser
Species Human (GRCh38)
Location 10:97791906-97791928
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072722900_1072722912 8 Left 1072722900 10:97791875-97791897 CCCCCCTTCCTGGTCTGAGGACT No data
Right 1072722912 10:97791906-97791928 GGTTGTGTTCAGCAAAGACAGGG No data
1072722904_1072722912 4 Left 1072722904 10:97791879-97791901 CCTTCCTGGTCTGAGGACTCCCA No data
Right 1072722912 10:97791906-97791928 GGTTGTGTTCAGCAAAGACAGGG No data
1072722903_1072722912 5 Left 1072722903 10:97791878-97791900 CCCTTCCTGGTCTGAGGACTCCC No data
Right 1072722912 10:97791906-97791928 GGTTGTGTTCAGCAAAGACAGGG No data
1072722905_1072722912 0 Left 1072722905 10:97791883-97791905 CCTGGTCTGAGGACTCCCATCCG No data
Right 1072722912 10:97791906-97791928 GGTTGTGTTCAGCAAAGACAGGG No data
1072722901_1072722912 7 Left 1072722901 10:97791876-97791898 CCCCCTTCCTGGTCTGAGGACTC No data
Right 1072722912 10:97791906-97791928 GGTTGTGTTCAGCAAAGACAGGG No data
1072722902_1072722912 6 Left 1072722902 10:97791877-97791899 CCCCTTCCTGGTCTGAGGACTCC No data
Right 1072722912 10:97791906-97791928 GGTTGTGTTCAGCAAAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072722912 Original CRISPR GGTTGTGTTCAGCAAAGACA GGG Intergenic
No off target data available for this crispr