ID: 1072722913

View in Genome Browser
Species Human (GRCh38)
Location 10:97791920-97791942
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072722908_1072722913 -1 Left 1072722908 10:97791898-97791920 CCCATCCGGGTTGTGTTCAGCAA No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722909_1072722913 -2 Left 1072722909 10:97791899-97791921 CCATCCGGGTTGTGTTCAGCAAA No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722900_1072722913 22 Left 1072722900 10:97791875-97791897 CCCCCCTTCCTGGTCTGAGGACT No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722902_1072722913 20 Left 1072722902 10:97791877-97791899 CCCCTTCCTGGTCTGAGGACTCC No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722905_1072722913 14 Left 1072722905 10:97791883-97791905 CCTGGTCTGAGGACTCCCATCCG No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722901_1072722913 21 Left 1072722901 10:97791876-97791898 CCCCCTTCCTGGTCTGAGGACTC No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722903_1072722913 19 Left 1072722903 10:97791878-97791900 CCCTTCCTGGTCTGAGGACTCCC No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722910_1072722913 -6 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data
1072722904_1072722913 18 Left 1072722904 10:97791879-97791901 CCTTCCTGGTCTGAGGACTCCCA No data
Right 1072722913 10:97791920-97791942 AAGACAGGGAATCCAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072722913 Original CRISPR AAGACAGGGAATCCAAGTGA TGG Intergenic
No off target data available for this crispr