ID: 1072722915

View in Genome Browser
Species Human (GRCh38)
Location 10:97791943-97791965
Sequence TGCTGCTTTGCCAGCCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072722910_1072722915 17 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722915 10:97791943-97791965 TGCTGCTTTGCCAGCCCTGTAGG No data
1072722908_1072722915 22 Left 1072722908 10:97791898-97791920 CCCATCCGGGTTGTGTTCAGCAA No data
Right 1072722915 10:97791943-97791965 TGCTGCTTTGCCAGCCCTGTAGG No data
1072722909_1072722915 21 Left 1072722909 10:97791899-97791921 CCATCCGGGTTGTGTTCAGCAAA No data
Right 1072722915 10:97791943-97791965 TGCTGCTTTGCCAGCCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072722915 Original CRISPR TGCTGCTTTGCCAGCCCTGT AGG Intergenic