ID: 1072722916

View in Genome Browser
Species Human (GRCh38)
Location 10:97791947-97791969
Sequence GCTTTGCCAGCCCTGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072722908_1072722916 26 Left 1072722908 10:97791898-97791920 CCCATCCGGGTTGTGTTCAGCAA No data
Right 1072722916 10:97791947-97791969 GCTTTGCCAGCCCTGTAGGTAGG No data
1072722914_1072722916 -8 Left 1072722914 10:97791932-97791954 CCAAGTGATGGTGCTGCTTTGCC No data
Right 1072722916 10:97791947-97791969 GCTTTGCCAGCCCTGTAGGTAGG No data
1072722910_1072722916 21 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722916 10:97791947-97791969 GCTTTGCCAGCCCTGTAGGTAGG No data
1072722909_1072722916 25 Left 1072722909 10:97791899-97791921 CCATCCGGGTTGTGTTCAGCAAA No data
Right 1072722916 10:97791947-97791969 GCTTTGCCAGCCCTGTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072722916 Original CRISPR GCTTTGCCAGCCCTGTAGGT AGG Intergenic