ID: 1072722919

View in Genome Browser
Species Human (GRCh38)
Location 10:97791954-97791976
Sequence CAGCCCTGTAGGTAGGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072722910_1072722919 28 Left 1072722910 10:97791903-97791925 CCGGGTTGTGTTCAGCAAAGACA No data
Right 1072722919 10:97791954-97791976 CAGCCCTGTAGGTAGGGCTGAGG No data
1072722914_1072722919 -1 Left 1072722914 10:97791932-97791954 CCAAGTGATGGTGCTGCTTTGCC No data
Right 1072722919 10:97791954-97791976 CAGCCCTGTAGGTAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072722919 Original CRISPR CAGCCCTGTAGGTAGGGCTG AGG Intergenic