ID: 1072725067

View in Genome Browser
Species Human (GRCh38)
Location 10:97807602-97807624
Sequence CTAGAGTTGTCCACTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072725067_1072725077 10 Left 1072725067 10:97807602-97807624 CCCCCAGCAGTGGACAACTCTAG No data
Right 1072725077 10:97807635-97807657 CACAGAGGCCTCAAGACGAGTGG No data
1072725067_1072725076 -5 Left 1072725067 10:97807602-97807624 CCCCCAGCAGTGGACAACTCTAG No data
Right 1072725076 10:97807620-97807642 TCTAGGGGGTGGCATCACAGAGG No data
1072725067_1072725080 26 Left 1072725067 10:97807602-97807624 CCCCCAGCAGTGGACAACTCTAG No data
Right 1072725080 10:97807651-97807673 CGAGTGGCACCCCATATGGTTGG No data
1072725067_1072725079 22 Left 1072725067 10:97807602-97807624 CCCCCAGCAGTGGACAACTCTAG No data
Right 1072725079 10:97807647-97807669 AAGACGAGTGGCACCCCATATGG No data
1072725067_1072725081 27 Left 1072725067 10:97807602-97807624 CCCCCAGCAGTGGACAACTCTAG No data
Right 1072725081 10:97807652-97807674 GAGTGGCACCCCATATGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072725067 Original CRISPR CTAGAGTTGTCCACTGCTGG GGG (reversed) Intergenic