ID: 1072725080

View in Genome Browser
Species Human (GRCh38)
Location 10:97807651-97807673
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072725070_1072725080 24 Left 1072725070 10:97807604-97807626 CCCAGCAGTGGACAACTCTAGGG No data
Right 1072725080 10:97807651-97807673 CGAGTGGCACCCCATATGGTTGG No data
1072725068_1072725080 25 Left 1072725068 10:97807603-97807625 CCCCAGCAGTGGACAACTCTAGG No data
Right 1072725080 10:97807651-97807673 CGAGTGGCACCCCATATGGTTGG No data
1072725067_1072725080 26 Left 1072725067 10:97807602-97807624 CCCCCAGCAGTGGACAACTCTAG No data
Right 1072725080 10:97807651-97807673 CGAGTGGCACCCCATATGGTTGG No data
1072725072_1072725080 23 Left 1072725072 10:97807605-97807627 CCAGCAGTGGACAACTCTAGGGG No data
Right 1072725080 10:97807651-97807673 CGAGTGGCACCCCATATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072725080 Original CRISPR CGAGTGGCACCCCATATGGT TGG Intergenic