ID: 1072727243

View in Genome Browser
Species Human (GRCh38)
Location 10:97822124-97822146
Sequence TGCCCCCCGTGAGCCCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072727243_1072727246 0 Left 1072727243 10:97822124-97822146 CCTGCCCGGGCTCACGGGGGGCA No data
Right 1072727246 10:97822147-97822169 TCACAACAGCCCCAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072727243 Original CRISPR TGCCCCCCGTGAGCCCGGGC AGG (reversed) Intergenic