ID: 1072727650

View in Genome Browser
Species Human (GRCh38)
Location 10:97824405-97824427
Sequence CCTATCTAGTGGGGGCTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072727650_1072727669 29 Left 1072727650 10:97824405-97824427 CCCCCGAGCCCCCACTAGATAGG No data
Right 1072727669 10:97824457-97824479 ACGTCAGGCCTTCAGAGGCTGGG No data
1072727650_1072727664 14 Left 1072727650 10:97824405-97824427 CCCCCGAGCCCCCACTAGATAGG No data
Right 1072727664 10:97824442-97824464 AGCTGCACAACCTCCACGTCAGG No data
1072727650_1072727668 28 Left 1072727650 10:97824405-97824427 CCCCCGAGCCCCCACTAGATAGG No data
Right 1072727668 10:97824456-97824478 CACGTCAGGCCTTCAGAGGCTGG No data
1072727650_1072727666 24 Left 1072727650 10:97824405-97824427 CCCCCGAGCCCCCACTAGATAGG No data
Right 1072727666 10:97824452-97824474 CCTCCACGTCAGGCCTTCAGAGG No data
1072727650_1072727670 30 Left 1072727650 10:97824405-97824427 CCCCCGAGCCCCCACTAGATAGG No data
Right 1072727670 10:97824458-97824480 CGTCAGGCCTTCAGAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072727650 Original CRISPR CCTATCTAGTGGGGGCTCGG GGG (reversed) Intergenic
No off target data available for this crispr