ID: 1072728567

View in Genome Browser
Species Human (GRCh38)
Location 10:97829748-97829770
Sequence TGGTAGGTATGGGACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072728567_1072728578 11 Left 1072728567 10:97829748-97829770 CCTCCCAGGTCCCATACCTACCA No data
Right 1072728578 10:97829782-97829804 TCCCGGATCCCACCTCTCCCAGG No data
1072728567_1072728584 26 Left 1072728567 10:97829748-97829770 CCTCCCAGGTCCCATACCTACCA No data
Right 1072728584 10:97829797-97829819 CTCCCAGGTCCCACACCTCCCGG No data
1072728567_1072728573 -6 Left 1072728567 10:97829748-97829770 CCTCCCAGGTCCCATACCTACCA No data
Right 1072728573 10:97829765-97829787 CTACCAGCTCCCACACCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072728567 Original CRISPR TGGTAGGTATGGGACCTGGG AGG (reversed) Intergenic
No off target data available for this crispr