ID: 1072730345

View in Genome Browser
Species Human (GRCh38)
Location 10:97841770-97841792
Sequence CCTCCCGGAAGGGGTGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072730345_1072730364 19 Left 1072730345 10:97841770-97841792 CCGCCCACACCCCTTCCGGGAGG No data
Right 1072730364 10:97841812-97841834 GCCAGGCCAGCCGCCCCGTCCGG No data
1072730345_1072730366 20 Left 1072730345 10:97841770-97841792 CCGCCCACACCCCTTCCGGGAGG No data
Right 1072730366 10:97841813-97841835 CCAGGCCAGCCGCCCCGTCCGGG No data
1072730345_1072730359 2 Left 1072730345 10:97841770-97841792 CCGCCCACACCCCTTCCGGGAGG No data
Right 1072730359 10:97841795-97841817 GGTGGGGGTCAGCCCCCGCCAGG No data
1072730345_1072730367 23 Left 1072730345 10:97841770-97841792 CCGCCCACACCCCTTCCGGGAGG No data
Right 1072730367 10:97841816-97841838 GGCCAGCCGCCCCGTCCGGGAGG No data
1072730345_1072730372 30 Left 1072730345 10:97841770-97841792 CCGCCCACACCCCTTCCGGGAGG No data
Right 1072730372 10:97841823-97841845 CGCCCCGTCCGGGAGGGAGGTGG No data
1072730345_1072730370 27 Left 1072730345 10:97841770-97841792 CCGCCCACACCCCTTCCGGGAGG No data
Right 1072730370 10:97841820-97841842 AGCCGCCCCGTCCGGGAGGGAGG No data
1072730345_1072730368 24 Left 1072730345 10:97841770-97841792 CCGCCCACACCCCTTCCGGGAGG No data
Right 1072730368 10:97841817-97841839 GCCAGCCGCCCCGTCCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072730345 Original CRISPR CCTCCCGGAAGGGGTGTGGG CGG (reversed) Intergenic