ID: 1072730687

View in Genome Browser
Species Human (GRCh38)
Location 10:97844261-97844283
Sequence CAGGGCAAACAGAGAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072730687_1072730696 5 Left 1072730687 10:97844261-97844283 CCATCCCCTCTCTGTTTGCCCTG No data
Right 1072730696 10:97844289-97844311 CATTCTCTGCTGGCCTGTTAAGG No data
1072730687_1072730692 -5 Left 1072730687 10:97844261-97844283 CCATCCCCTCTCTGTTTGCCCTG No data
Right 1072730692 10:97844279-97844301 CCCTGTGTCCCATTCTCTGCTGG No data
1072730687_1072730697 6 Left 1072730687 10:97844261-97844283 CCATCCCCTCTCTGTTTGCCCTG No data
Right 1072730697 10:97844290-97844312 ATTCTCTGCTGGCCTGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072730687 Original CRISPR CAGGGCAAACAGAGAGGGGA TGG (reversed) Intergenic
No off target data available for this crispr