ID: 1072730692

View in Genome Browser
Species Human (GRCh38)
Location 10:97844279-97844301
Sequence CCCTGTGTCCCATTCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072730689_1072730692 -10 Left 1072730689 10:97844266-97844288 CCCTCTCTGTTTGCCCTGTGTCC No data
Right 1072730692 10:97844279-97844301 CCCTGTGTCCCATTCTCTGCTGG No data
1072730686_1072730692 1 Left 1072730686 10:97844255-97844277 CCTGAGCCATCCCCTCTCTGTTT No data
Right 1072730692 10:97844279-97844301 CCCTGTGTCCCATTCTCTGCTGG No data
1072730687_1072730692 -5 Left 1072730687 10:97844261-97844283 CCATCCCCTCTCTGTTTGCCCTG No data
Right 1072730692 10:97844279-97844301 CCCTGTGTCCCATTCTCTGCTGG No data
1072730685_1072730692 6 Left 1072730685 10:97844250-97844272 CCTCTCCTGAGCCATCCCCTCTC No data
Right 1072730692 10:97844279-97844301 CCCTGTGTCCCATTCTCTGCTGG No data
1072730684_1072730692 30 Left 1072730684 10:97844226-97844248 CCTCTGTGGGAAATTGTCTGTGC No data
Right 1072730692 10:97844279-97844301 CCCTGTGTCCCATTCTCTGCTGG No data
1072730688_1072730692 -9 Left 1072730688 10:97844265-97844287 CCCCTCTCTGTTTGCCCTGTGTC No data
Right 1072730692 10:97844279-97844301 CCCTGTGTCCCATTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072730692 Original CRISPR CCCTGTGTCCCATTCTCTGC TGG Intergenic
No off target data available for this crispr