ID: 1072730697

View in Genome Browser
Species Human (GRCh38)
Location 10:97844290-97844312
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072730688_1072730697 2 Left 1072730688 10:97844265-97844287 CCCCTCTCTGTTTGCCCTGTGTC No data
Right 1072730697 10:97844290-97844312 ATTCTCTGCTGGCCTGTTAAGGG No data
1072730685_1072730697 17 Left 1072730685 10:97844250-97844272 CCTCTCCTGAGCCATCCCCTCTC No data
Right 1072730697 10:97844290-97844312 ATTCTCTGCTGGCCTGTTAAGGG No data
1072730690_1072730697 0 Left 1072730690 10:97844267-97844289 CCTCTCTGTTTGCCCTGTGTCCC No data
Right 1072730697 10:97844290-97844312 ATTCTCTGCTGGCCTGTTAAGGG No data
1072730687_1072730697 6 Left 1072730687 10:97844261-97844283 CCATCCCCTCTCTGTTTGCCCTG No data
Right 1072730697 10:97844290-97844312 ATTCTCTGCTGGCCTGTTAAGGG No data
1072730689_1072730697 1 Left 1072730689 10:97844266-97844288 CCCTCTCTGTTTGCCCTGTGTCC No data
Right 1072730697 10:97844290-97844312 ATTCTCTGCTGGCCTGTTAAGGG No data
1072730686_1072730697 12 Left 1072730686 10:97844255-97844277 CCTGAGCCATCCCCTCTCTGTTT No data
Right 1072730697 10:97844290-97844312 ATTCTCTGCTGGCCTGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072730697 Original CRISPR ATTCTCTGCTGGCCTGTTAA GGG Intergenic
No off target data available for this crispr