ID: 1072733997

View in Genome Browser
Species Human (GRCh38)
Location 10:97867019-97867041
Sequence TGTTCTAGTGGAAGAGAAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 213}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072733994_1072733997 11 Left 1072733994 10:97866985-97867007 CCTAGGGCTACCAGGGAACATAC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733990_1072733997 17 Left 1072733990 10:97866979-97867001 CCCTCCCCTAGGGCTACCAGGGA 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733988_1072733997 18 Left 1072733988 10:97866978-97867000 CCCCTCCCCTAGGGCTACCAGGG 0: 1
1: 0
2: 3
3: 20
4: 247
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733992_1072733997 13 Left 1072733992 10:97866983-97867005 CCCCTAGGGCTACCAGGGAACAT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733995_1072733997 1 Left 1072733995 10:97866995-97867017 CCAGGGAACATACTCTACTGCAT 0: 1
1: 0
2: 0
3: 2
4: 96
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733984_1072733997 25 Left 1072733984 10:97866971-97866993 CCCCTTGCCCCTCCCCTAGGGCT 0: 1
1: 0
2: 3
3: 46
4: 444
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733985_1072733997 24 Left 1072733985 10:97866972-97866994 CCCTTGCCCCTCCCCTAGGGCTA 0: 1
1: 0
2: 0
3: 22
4: 266
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733993_1072733997 12 Left 1072733993 10:97866984-97867006 CCCTAGGGCTACCAGGGAACATA 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733991_1072733997 16 Left 1072733991 10:97866980-97867002 CCTCCCCTAGGGCTACCAGGGAA 0: 1
1: 0
2: 2
3: 20
4: 124
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213
1072733986_1072733997 23 Left 1072733986 10:97866973-97866995 CCTTGCCCCTCCCCTAGGGCTAC 0: 1
1: 1
2: 4
3: 39
4: 322
Right 1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG 0: 1
1: 0
2: 3
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072733997 Original CRISPR TGTTCTAGTGGAAGAGAAGC CGG Exonic
901247011 1:7739693-7739715 TGTTCTCGTGGTAGTGAAGAAGG - Intronic
905142167 1:35856104-35856126 TGTGGTGGTGGAAGAAAAGCCGG + Exonic
906506673 1:46384905-46384927 TGTTTTAAGGGAAGAGAAGGTGG + Intergenic
906857910 1:49328321-49328343 AGTATTAGTGGAAGAGAAGAGGG + Intronic
908429803 1:64045231-64045253 TGTTTTAGTTGAAGAAAATCTGG - Intronic
911032431 1:93503976-93503998 TGGTATAGTGGAAGAGAATTAGG + Intronic
913105316 1:115609026-115609048 TGGGCTAGAGGGAGAGAAGCAGG - Intergenic
913601801 1:120428433-120428455 GGAGATAGTGGAAGAGAAGCAGG + Intergenic
914085242 1:144448170-144448192 GGAGATAGTGGAAGAGAAGCAGG - Intronic
914191128 1:145412145-145412167 GGAGATAGTGGAAGAGAAGCAGG - Intergenic
914230301 1:145759965-145759987 TGCTATGGTGGAAGAAAAGCAGG - Intronic
914362986 1:146952072-146952094 GGAGATAGTGGAAGAGAAGCAGG + Intronic
914488693 1:148135067-148135089 GGAGATAGTGGAAGAGAAGCAGG - Intronic
914589062 1:149090148-149090170 GGAGATAGTGGAAGAGAAGCAGG - Intronic
917307268 1:173639425-173639447 TTTTTTAGTGGAAGAGAAGATGG - Intronic
918084724 1:181236005-181236027 GTTTCTGGAGGAAGAGAAGCCGG + Intergenic
919507864 1:198422546-198422568 TGGTGTACTGGAAGAAAAGCAGG + Intergenic
919518476 1:198556834-198556856 TGTTTTATTGGAAGTGAAGATGG + Intergenic
922044232 1:221928182-221928204 TGATCTAGTGAAACACAAGCTGG + Intergenic
924134973 1:240956243-240956265 CTTTCCTGTGGAAGAGAAGCAGG + Intronic
1064490361 10:15849469-15849491 TTTTTTAAAGGAAGAGAAGCAGG + Intronic
1064516662 10:16156670-16156692 TCTTCTAGTGAAGGGGAAGCTGG - Intergenic
1064965830 10:21014309-21014331 TGGTCTAGTGGGAGAGAGGGTGG - Intronic
1066164769 10:32774647-32774669 TTTTCTAGGGGAAGTGATGCTGG + Intronic
1067859185 10:49827104-49827126 TTTTCTGGTGGAAGGGAAGGAGG + Intronic
1068510397 10:57958285-57958307 TGTTATCTTGGAAGTGAAGCTGG + Intergenic
1068944822 10:62719239-62719261 GTTTCTAGTGGAAGAGCAGAGGG - Intergenic
1070090637 10:73281966-73281988 GATTCTAGTGAAAGAGAAGGTGG + Intronic
1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG + Exonic
1072945492 10:99806326-99806348 TGCTCTAGTGAAAGACTAGCAGG - Intronic
1073279486 10:102342476-102342498 GGTAGTAGGGGAAGAGAAGCAGG + Intronic
1073904768 10:108265347-108265369 TAATCTAGTGGAAGAAAAGAAGG - Intergenic
1074697813 10:116066446-116066468 TGTTCCAGTTGAGGAGAAACAGG - Intronic
1076912202 10:133396326-133396348 TGTTCTAACGGAAGAGTTGCCGG + Intronic
1077029939 11:460841-460863 AGTGCGTGTGGAAGAGAAGCTGG + Intronic
1077803428 11:5565391-5565413 TGTCCTAGTGGATGTGAAGTAGG + Intronic
1080201208 11:29672629-29672651 TGGCCTGGTGGCAGAGAAGCAGG - Intergenic
1081523998 11:43911367-43911389 TACTCAGGTGGAAGAGAAGCTGG + Intronic
1082854367 11:57793223-57793245 TATTCTACTGGAAGAGGAGCAGG + Exonic
1082927941 11:58570632-58570654 TGATCCAGGGGAAGAGGAGCTGG + Exonic
1084907270 11:72357804-72357826 GGTTCTGCTGGAAGAGAGGCAGG + Intronic
1084915621 11:72426869-72426891 TCCTTTTGTGGAAGAGAAGCTGG - Intronic
1084991364 11:72928486-72928508 TATTTAAGTGGAAGAGAAGGGGG - Intronic
1085115521 11:73928228-73928250 TGATCTAGAGGAAGAGATGGTGG + Intergenic
1086238150 11:84657397-84657419 TGTTCTAGGGGCAGGGAGGCAGG - Intronic
1088403025 11:109441908-109441930 TATTCTAGGGGCAAAGAAGCTGG - Intergenic
1089362980 11:117903453-117903475 TGTTCTGAGGGAAGAAAAGCAGG + Intronic
1089637264 11:119823066-119823088 GGTTCCAGTGGAAGGGAAGAGGG + Intergenic
1090026781 11:123174437-123174459 TGTCCAGATGGAAGAGAAGCTGG - Intronic
1090119769 11:124014078-124014100 TGGCCTAGTGTAAGAGAAACAGG + Intergenic
1091656932 12:2352980-2353002 TGTTATTGTGGAAGAAAAGGGGG + Intronic
1098092809 12:66922219-66922241 TGTTCTAGAGCCAGGGAAGCTGG - Intergenic
1099108628 12:78528059-78528081 TATTTTAGTAGAAGACAAGCAGG + Intergenic
1099365249 12:81759389-81759411 TGTTCCAGAGGAAGAGGAGGTGG - Intronic
1101802525 12:108034760-108034782 TGTTTCAGTGGAAGAGATGATGG + Intergenic
1102769639 12:115464134-115464156 TGGTGTAGTGGAAAAGACGCTGG - Intergenic
1102858313 12:116314169-116314191 TGTTCTAGCTGTAGAGAAGAGGG - Intergenic
1104276241 12:127330770-127330792 AGTCCTAGTGGTAGTGAAGCAGG + Intergenic
1104422907 12:128651846-128651868 TGATGGAGTGGAGGAGAAGCAGG + Intronic
1109492297 13:63117662-63117684 TGTTCAAGGGTAAGAGAAGAAGG + Intergenic
1110642061 13:77836528-77836550 TGTCCCAGTGGAACCGAAGCAGG - Intergenic
1112168556 13:96946372-96946394 TGTCATAGAGGAAGTGAAGCTGG + Intergenic
1112953361 13:105030054-105030076 TGATAGAGAGGAAGAGAAGCTGG - Intergenic
1113259861 13:108549781-108549803 TCTTCTAGTGCAGGAGGAGCTGG - Intergenic
1113797976 13:113069804-113069826 TGACCTAGAGGGAGAGAAGCAGG + Intronic
1117414091 14:55477836-55477858 TGGTCATGTGGAAGAGACGCAGG + Intergenic
1118777971 14:68985626-68985648 TGTTCCAGTGAAGCAGAAGCTGG - Intergenic
1124012284 15:25848658-25848680 TGTAAAAGTGGAAGAAAAGCGGG - Intronic
1124201982 15:27686601-27686623 TCTTATAGGGGAAGGGAAGCTGG - Intergenic
1133208671 16:4249996-4250018 AGTACTAGTGGAAGAAAAACAGG + Intergenic
1137986398 16:53111815-53111837 TGTTCTAGTGGCAGAGCATTTGG - Intronic
1138308956 16:56006892-56006914 TGCCCTAGAGGAAGAAAAGCTGG + Intergenic
1140145211 16:72300305-72300327 TGGTCTAGAGGAAGGGAAGTTGG + Intergenic
1140950279 16:79810376-79810398 TGTTCTAATGGGTGAGATGCAGG - Intergenic
1143367502 17:6417819-6417841 TGTTTGTGTGGAAGAGCAGCTGG - Intronic
1143832803 17:9665745-9665767 TGTTCTTGTGAAAGAGAAGCTGG + Intronic
1143846181 17:9774166-9774188 TGCTCTGGTGGGTGAGAAGCTGG + Intronic
1144326282 17:14184686-14184708 TGTTCTAGTGGAAGAACAGAGGG - Intronic
1144410434 17:14995266-14995288 TGTTCTTATGCAAGAGAACCAGG - Intergenic
1144475159 17:15581559-15581581 TGTTCTAGTGGAAGAATAGAGGG - Intronic
1144849099 17:18235114-18235136 TGTGCTGCTGGAAGAGGAGCTGG + Exonic
1144932185 17:18868689-18868711 TCTTCTAGTGGAAAAGGAACAGG - Intronic
1146147307 17:30431154-30431176 TGTCCTAGTGGGTGAGAAGTAGG + Intronic
1146514828 17:33480871-33480893 GGTTGCAGTGGAAGAGAAGGAGG - Intronic
1147672053 17:42181925-42181947 CCTTCAAGTGGAAGAGAGGCTGG + Intergenic
1148288799 17:46421950-46421972 TGTACTAGTGATAGAAAAGCAGG + Intergenic
1148310968 17:46639527-46639549 TGTACTAGTGATAGAAAAGCAGG + Intronic
1148588994 17:48801379-48801401 TGATCTTCTGGAAGGGAAGCCGG + Exonic
1149850231 17:60029747-60029769 TCTTCCAGTGGCAGAGAAGTAGG + Intergenic
1149859935 17:60116777-60116799 TCTTCCAGTGGCAGAGAAGTAGG - Intergenic
1153995233 18:10434546-10434568 TGTCCTAGAGGAGGAGATGCTGG - Intergenic
1155015016 18:21826914-21826936 TTTTCTAGTAGAAGTGAAACAGG + Intronic
1155241141 18:23864847-23864869 GGTTCTTCTGGAAAAGAAGCCGG + Exonic
1155882666 18:31169464-31169486 TTTTCTAATGGAAGGGAAGGAGG + Intergenic
1157010341 18:43640849-43640871 TGTTCAAGGGCAAGAGAAGATGG - Intergenic
1157869525 18:51217488-51217510 GGTTCTAATGGAAGAGAAGGTGG - Intronic
1161459740 19:4389615-4389637 CGCCCTAGAGGAAGAGAAGCAGG - Intronic
1164409600 19:27989758-27989780 TCTTTCAGTGGAAGAGAGGCAGG - Intergenic
1165856783 19:38883753-38883775 TGTTCTAGAGGGAGAGATGGAGG + Exonic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167906825 19:52668088-52668110 TGTTTTAAAGGAAGAGAAGGTGG - Intronic
1168051165 19:53830987-53831009 TGTCCTAGGGCAAGAGAAGATGG + Intergenic
925777488 2:7349271-7349293 TGTTCTAATGGGAGAGGCGCAGG - Intergenic
926412123 2:12615409-12615431 TGTTCTTGGGGAAGATAAGCAGG + Intergenic
927147020 2:20172826-20172848 GGTTATAGGGGAAGAGAAGTGGG + Intergenic
928058136 2:28079436-28079458 TGTTGTAGTACAAGAGAGGCAGG + Intronic
931675417 2:64690394-64690416 TGTTGTAGTGGATGAGAAGTGGG - Intronic
932783524 2:74579236-74579258 TGTGATAGTGGAAGAAAGGCTGG + Intronic
933401410 2:81801793-81801815 TGTTGTAGAGGAAGAAGAGCAGG - Intergenic
933873602 2:86595484-86595506 TGTTCAAGTGAAAGAGTTGCAGG + Intronic
940524722 2:154799011-154799033 TGTTGAAGTGGGAGAGAAACAGG + Intronic
941857892 2:170249043-170249065 TGTTCTGATGGTAGATAAGCAGG - Intronic
942182456 2:173393307-173393329 TGTTTAAATGGAAGAGAAACTGG - Intergenic
944384046 2:199144327-199144349 TGTTCTAGAGGAAGAGGTGGTGG - Intergenic
945963574 2:216162011-216162033 TGTTCTAGTGAAACAGAAGAAGG + Exonic
946575935 2:221075450-221075472 TGTTAAAGTGGAAGAGAGGTTGG + Intergenic
948949585 2:241240316-241240338 GGTTGTTGTGGAAGAGAAGTAGG - Intronic
1169607548 20:7339735-7339757 TGTTGTAAGGGAAGAGAAGATGG - Intergenic
1172168072 20:32911041-32911063 TGTTATAATGCAAGAGTAGCAGG - Intronic
1172412979 20:34740393-34740415 TGGCCTAGTGGAGGAGAAGGTGG - Exonic
1173388428 20:42609681-42609703 TCTCCTAGAGGAAGAGAAGCTGG - Intronic
1174616008 20:51836002-51836024 TGTTATATTGGAGGAAAAGCAGG - Intergenic
1174857930 20:54064524-54064546 AGTTCTGGGGGAAGGGAAGCTGG - Intronic
1175606759 20:60317640-60317662 TGTTGTACTGGGAGGGAAGCTGG - Intergenic
1177409813 21:20715443-20715465 TGTTCTAGTGTAAGATGTGCTGG + Intergenic
1178837030 21:36107558-36107580 TGTTTTAAGGGAAGAGAAGGTGG - Intergenic
1179533116 21:42033450-42033472 TGTTCAAGTGGAAGAGACTCAGG - Intergenic
1180670525 22:17549115-17549137 TGGTCCAGAGGAAGAGAAGCTGG + Exonic
1181967852 22:26669088-26669110 TGTTCTTGGGGAACAGAAGGTGG + Intergenic
1182411836 22:30193779-30193801 TGTTCAACTGCAAGGGAAGCTGG - Intergenic
1182550086 22:31096239-31096261 TGATCCAGGGGAAGAGTAGCTGG - Intronic
1182713483 22:32336976-32336998 TGTTCCAGAGAAAGAAAAGCAGG + Intergenic
1182878554 22:33713376-33713398 TGTACTAGTGGAATAGCAGGGGG - Intronic
1185178372 22:49344824-49344846 TGTTTTGCTGGAACAGAAGCGGG + Intergenic
950581398 3:13864520-13864542 GGATCTAGTGGAAGAGAAACAGG - Intronic
950898491 3:16475138-16475160 TGTGCAAGTGGAAGGGGAGCTGG - Intronic
951280225 3:20739176-20739198 TGTTCTAGAGAAAGAAAGGCTGG + Intergenic
951508713 3:23478605-23478627 TCTTCCCGTAGAAGAGAAGCTGG + Intronic
951633962 3:24752756-24752778 TGGTCTTGTGCAAGAGTAGCAGG - Intergenic
951674238 3:25218623-25218645 TCTTCAACTGCAAGAGAAGCAGG + Intronic
953008479 3:39000436-39000458 TGATTGAGTGGAAGAGAAGCTGG - Intergenic
954850358 3:53594826-53594848 TGGTCAAGGGGAAGAAAAGCAGG - Intronic
955261216 3:57392638-57392660 TGTGCTACGGGAAGATAAGCAGG + Intronic
955831087 3:63004893-63004915 TGGTGTAGTTGAGGAGAAGCAGG - Intergenic
955834465 3:63039490-63039512 TATTCAAGAGGAAGAAAAGCAGG - Intergenic
958036029 3:88171480-88171502 TGTCCAAGAGCAAGAGAAGCTGG - Intergenic
958631332 3:96686837-96686859 TGTTCTTGTGGCAGAGAGGTGGG + Intergenic
959528327 3:107402763-107402785 TGTTCTAGTCTCTGAGAAGCTGG - Intergenic
959840374 3:110968071-110968093 TTTTTCAGTGGAAGAGAAGATGG + Intergenic
961682071 3:128606097-128606119 TGTTTCTCTGGAAGAGAAGCTGG + Intergenic
962436198 3:135369106-135369128 TTTTCCAGTGGCAGAGAAGGGGG - Intergenic
963660827 3:148127078-148127100 AGTTCTAAAGGTAGAGAAGCTGG - Intergenic
965704722 3:171494774-171494796 GGTTGGAGTGGAGGAGAAGCAGG + Intergenic
966212874 3:177470971-177470993 TTTCCCAGCGGAAGAGAAGCTGG + Intergenic
966305813 3:178533597-178533619 TGTGGTAGTGAAAGAGGAGCAGG - Intronic
967322990 3:188212558-188212580 TGATCTATTGGAAGAGAGGGAGG + Intronic
968180168 3:196588840-196588862 TGTTCTAGTCCCAGTGAAGCAGG + Exonic
968533177 4:1106196-1106218 TGGTTTAGAGAAAGAGAAGCAGG + Intronic
969159024 4:5239150-5239172 TGTTCAAGAGGAGGAGAAGGGGG + Intronic
969401124 4:6956354-6956376 TCTTCTATTCCAAGAGAAGCTGG + Intronic
969673687 4:8603296-8603318 TGTTCTAGTGGATGACAGGATGG + Intronic
969943823 4:10762205-10762227 TGTTCTAGTGGAAAAGAGATGGG + Intergenic
973887874 4:55341313-55341335 TGTTTTAAGGGAAGAGAAGGTGG - Intergenic
975328970 4:73091974-73091996 TATGCTAATGGAAGAGAAACTGG + Exonic
975497127 4:75047075-75047097 TGGGGAAGTGGAAGAGAAGCTGG + Exonic
975498701 4:75061643-75061665 TTTTCTAGTGGAATATAAGTTGG + Intergenic
975555099 4:75655073-75655095 GGTTCTTGTGGCAGAGAAACAGG + Exonic
978723490 4:111942862-111942884 TGTTTTAAAGGCAGAGAAGCAGG - Intergenic
979697575 4:123631047-123631069 TGATCTAGGGGAAGGGAAGAAGG - Intergenic
979925635 4:126559741-126559763 AGTTATAGGGGAGGAGAAGCAGG + Intergenic
984036421 4:174673648-174673670 TTTTCTAGTGGAAGAAAGCCTGG - Intronic
985009701 4:185569784-185569806 TTTTCTAGGGGAAGAAGAGCAGG - Intergenic
986269337 5:6217645-6217667 TATTCACGTGGAAAAGAAGCAGG + Intergenic
987674425 5:21056332-21056354 TTTTCTATTGTAAGAGAAGTGGG - Intergenic
989728145 5:44612934-44612956 TTGTCTATTGGAAGAGAAGAAGG + Intergenic
990199449 5:53354736-53354758 TGTTCTTCGGGAAGAGAAGAGGG - Intergenic
991262364 5:64680659-64680681 TGTTCAAGGGGAGGAGAAGATGG + Intergenic
992238248 5:74735144-74735166 TATTCTAGTGGAAAAGGATCAGG - Intronic
996151772 5:120045839-120045861 TGTTTTATTTGAAGAGAAACAGG + Intergenic
998379741 5:141715772-141715794 TCTGCTCCTGGAAGAGAAGCTGG + Intergenic
998735012 5:145127590-145127612 TGTTGTACTGGAAGAGAAAAAGG + Intergenic
1001057447 5:168461438-168461460 GGTTCTGGTGACAGAGAAGCTGG + Intronic
1001230315 5:169981276-169981298 CGTTCTAGTGGTAGAGAAACAGG - Intronic
1002032512 5:176441020-176441042 TGTTCTTGTGGGAGGGAGGCAGG - Intergenic
1002108199 5:176890727-176890749 TGCTCTGGAGGTAGAGAAGCTGG + Exonic
1006186361 6:32183747-32183769 TGTTCTAGAAGCAGAGAAGCAGG + Exonic
1007299884 6:40859515-40859537 TGTTCCAGAGGAAGTGATGCTGG - Intergenic
1008955857 6:57214609-57214631 TGTTTCAATGGAAGACAAGCAGG + Intronic
1015102279 6:129495586-129495608 TGTTCTAGTGGTAGAGAAGAAGG - Intronic
1016268425 6:142258764-142258786 TGTTTTAAAGGAAGGGAAGCCGG - Intergenic
1016396782 6:143632120-143632142 TGTTCCAGAAGTAGAGAAGCAGG + Intronic
1019037683 6:169075342-169075364 TTTTTCAGTGGAAGAGAAGCAGG - Intergenic
1019993297 7:4707249-4707271 TGTTCTGGTGGAGGGGACGCTGG + Intronic
1020745256 7:12071774-12071796 TTTTTTAGTGGAAGAGAAAATGG - Intergenic
1025603822 7:63024522-63024544 GGTTATAGTGGAGGAAAAGCTGG - Intergenic
1026957601 7:74387557-74387579 TGTTCTGGTGAACAAGAAGCAGG - Intronic
1029948105 7:104554934-104554956 TGTTCAAGGGCAAGAGAAGATGG + Intronic
1031180168 7:118404202-118404224 TGGTCTAATGGAAAAGAAGATGG - Intergenic
1031497590 7:122469793-122469815 TGATCTAGTGGAACAGAAGCAGG + Intronic
1032785771 7:135198148-135198170 TGCCCTAGAGGAAAAGAAGCTGG + Exonic
1033966036 7:146976185-146976207 TGTTGTAGTGCGAGAGAAGCAGG - Intronic
1036636890 8:10557373-10557395 TGTTCAAGGGTAAGAGAAGATGG - Intergenic
1039021246 8:33209171-33209193 TGCAATAGTGGAACAGAAGCAGG + Intergenic
1039463731 8:37767348-37767370 GGTTCTTGAGGAAGAGAAGTGGG - Intronic
1042377554 8:68071808-68071830 TGCCCTAGTGGAAAACAAGCAGG - Intronic
1042654271 8:71078642-71078664 GGTTCTACTGGAAGGGAAGAAGG + Intergenic
1043549817 8:81358122-81358144 TGATGAAGTGGGAGAGAAGCAGG + Intergenic
1044030959 8:87236644-87236666 GGTTCTAGTGGAAGAAAACATGG - Intronic
1045031344 8:98139424-98139446 AGCTCTAGTGGAAGAGGACCAGG + Intronic
1046597849 8:116282455-116282477 TTTTCAAGTGGAAGTGAAGGTGG + Intergenic
1047716981 8:127604628-127604650 TTTTCTGGTTGAAGAGGAGCTGG - Intergenic
1048140350 8:131788253-131788275 TTTACAAGTGGTAGAGAAGCAGG - Intergenic
1049014852 8:139913017-139913039 TGTTCAACAGGAAGAGAACCTGG - Intronic
1049745417 8:144261160-144261182 TGTTCTACTTCAAGAGCAGCTGG + Exonic
1051937509 9:22460745-22460767 TTTTCTAGTGGAAGAGAGAAAGG + Intergenic
1052175752 9:25460837-25460859 TGTGCAAGTGGAAGTCAAGCGGG - Intergenic
1058714737 9:107713598-107713620 TGTTCTGGTGGAGGAGTAGAGGG + Intergenic
1059082881 9:111268722-111268744 TGGTCTAGAGGGAGAGAAGCAGG - Intergenic
1059539191 9:115113885-115113907 TTCTAAAGTGGAAGAGAAGCTGG + Intronic
1061787043 9:133035631-133035653 TTTTTCAGTGGAAGAGAAGATGG + Intronic
1186504877 X:10083237-10083259 TGTGCTCCTGGAAGAGAGGCGGG + Intronic
1187013568 X:15304246-15304268 TTTTCCAGTGGATGAGAATCAGG + Intronic
1187216641 X:17283283-17283305 GGTTCCAGTGGAGGGGAAGCGGG + Intergenic
1187481048 X:19656030-19656052 TATTCTAGCTGAAGAAAAGCAGG + Intronic
1187951457 X:24474929-24474951 TGTTCTAAAGGAAAAGAAGATGG - Intronic
1191889984 X:65929631-65929653 TGTTTTAAGGGAAGAGAAGGTGG + Intergenic
1193656934 X:84210057-84210079 TATTTTAGTGGAAGAGAACTGGG - Intergenic
1194098209 X:89670003-89670025 TGTACTAGAAGAAGAGAAGAGGG - Intergenic
1196535691 X:116841131-116841153 TGTACTAAGTGAAGAGAAGCTGG - Intergenic
1198079757 X:133228104-133228126 AGTTGGAGTGGAAGAGAAGGGGG + Intergenic
1200236141 X:154468644-154468666 TGTCCTAGGGCAAGAGAAGGGGG - Exonic
1200451227 Y:3331391-3331413 TGTACTAGAAGAAGAGAAGAGGG - Intergenic
1202259211 Y:22951975-22951997 TGTTCTGTTGGAAGAGAAATTGG + Intergenic
1202412197 Y:24585719-24585741 TGTTCTGTTGGAAGAGAAATTGG + Intergenic
1202458583 Y:25084349-25084371 TGTTCTGTTGGAAGAGAAATTGG - Intergenic