ID: 1072734382

View in Genome Browser
Species Human (GRCh38)
Location 10:97869204-97869226
Sequence CTCCACTTCCAGGGCATCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072734372_1072734382 8 Left 1072734372 10:97869173-97869195 CCATGCCTGGGTTTTGAGGCCGG 0: 1
1: 0
2: 2
3: 14
4: 140
Right 1072734382 10:97869204-97869226 CTCCACTTCCAGGGCATCACGGG 0: 1
1: 0
2: 2
3: 8
4: 177
1072734375_1072734382 3 Left 1072734375 10:97869178-97869200 CCTGGGTTTTGAGGCCGGGCTGG 0: 1
1: 0
2: 1
3: 161
4: 2844
Right 1072734382 10:97869204-97869226 CTCCACTTCCAGGGCATCACGGG 0: 1
1: 0
2: 2
3: 8
4: 177
1072734368_1072734382 26 Left 1072734368 10:97869155-97869177 CCAGGGAAGGACTTGGAGCCATG 0: 1
1: 1
2: 4
3: 21
4: 224
Right 1072734382 10:97869204-97869226 CTCCACTTCCAGGGCATCACGGG 0: 1
1: 0
2: 2
3: 8
4: 177
1072734367_1072734382 27 Left 1072734367 10:97869154-97869176 CCCAGGGAAGGACTTGGAGCCAT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1072734382 10:97869204-97869226 CTCCACTTCCAGGGCATCACGGG 0: 1
1: 0
2: 2
3: 8
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072734382 Original CRISPR CTCCACTTCCAGGGCATCAC GGG Exonic
900185819 1:1332789-1332811 CTCACCTGCCAGGGCTTCACGGG - Exonic
900928377 1:5720147-5720169 CTGCACCTCCATGGCATCAGGGG - Intergenic
902664868 1:17930433-17930455 CTCCACTTCCCGGTCACCCCTGG + Intergenic
902921949 1:19671542-19671564 CTCCACCTCCAGGCCAGCTCTGG - Intronic
903884254 1:26531780-26531802 CTCCACTTCCTGGGCCTGAGAGG + Intronic
906037269 1:42759200-42759222 GACCTCTTCCAGGCCATCACAGG - Exonic
907268078 1:53274907-53274929 CTCCAGTTCCAGTCCCTCACAGG + Intronic
907425498 1:54376719-54376741 CTCCACCACCAGCGCATCAAAGG + Intronic
915075328 1:153303853-153303875 TTACCCTTCCTGGGCATCACTGG + Exonic
915381411 1:155444698-155444720 CTCCACCTCCCGGGGTTCACGGG + Intronic
918072271 1:181141674-181141696 CTCCACTTCCGGGGCCTCGAGGG + Intergenic
920206220 1:204294166-204294188 CTCCAATTCCAGGCCATCCCAGG + Intronic
920217348 1:204370373-204370395 CTCGCCTTCCAGCGCTTCACCGG - Intronic
920833667 1:209487983-209488005 CTCCACAGCCAGGGAATCATTGG - Intergenic
922371226 1:224912110-224912132 CTCTAATTCCAGAGGATCACTGG + Intronic
1063138701 10:3238404-3238426 CTCCACTTCCAGACTAGCACAGG - Intergenic
1067208951 10:44242606-44242628 GTCCACTTCCTGGGCTTCCCAGG - Intergenic
1067577702 10:47418692-47418714 CCCCATGTCCAGGGCATCTCAGG - Intergenic
1069975671 10:72210785-72210807 CTCCACCTCGTAGGCATCACAGG + Exonic
1070601118 10:77867040-77867062 GTGCTCTTCCTGGGCATCACAGG - Intronic
1070956770 10:80469067-80469089 CTCCATTTCCAAGACATCCCCGG - Intronic
1072734382 10:97869204-97869226 CTCCACTTCCAGGGCATCACGGG + Exonic
1073340882 10:102743854-102743876 CTCCAGTTCCAGCGCTTCATTGG - Intergenic
1075415313 10:122258350-122258372 CGCCACTTCCCGAGCATCCCAGG - Intergenic
1076198640 10:128540413-128540435 CTGAACTTCCAGGGAATGACGGG + Intergenic
1076504437 10:130962654-130962676 CTCCACTCGGAGGCCATCACTGG - Intergenic
1077473938 11:2777651-2777673 TTCCACTCCCAGGGCGACACAGG - Intronic
1077693214 11:4368234-4368256 TTCCACTTGCTGGGCATCCCTGG - Exonic
1079987230 11:27212060-27212082 GTCCATTTCCAGTTCATCACTGG + Intergenic
1081839107 11:46182986-46183008 CTCCTATTCCAGGACATCTCTGG - Intergenic
1082950029 11:58804828-58804850 TTCCACCTCCAGGGCTTCTCAGG - Intergenic
1083594604 11:63912947-63912969 CTCCACTTCCTGGCCTTCCCAGG - Exonic
1086146948 11:83562396-83562418 CCCCCCACCCAGGGCATCACAGG - Intronic
1088823094 11:113473492-113473514 CTCCACTTTCTGGGCACCTCAGG + Intronic
1088916035 11:114228661-114228683 GTCCCTTTGCAGGGCATCACAGG + Intronic
1090190160 11:124761936-124761958 ATCCCACTCCAGGGCATCACTGG - Intronic
1091585879 12:1816397-1816419 CTCCTCTTTCAGGTCATGACAGG - Intronic
1091631179 12:2162148-2162170 CTACCCTTCCAGGGCCTCTCAGG + Intronic
1100821951 12:98439792-98439814 CTCCAATCCCAGGACACCACAGG + Intergenic
1100913336 12:99390299-99390321 CTCCTCTTCCAGGGCTGGACAGG + Intronic
1102544749 12:113646362-113646384 CTCCACTTAGAGGCCATCAAAGG - Intergenic
1102998034 12:117364721-117364743 CTCCACTTGCTGGGGATCTCTGG - Intronic
1104585585 12:130045610-130045632 CTCCACTTCCCAGGGTTCACAGG + Intergenic
1104614999 12:130260041-130260063 GTCCCCTTCCAGGGCACTACTGG - Intergenic
1104623644 12:130336931-130336953 CTGCATTTCCAAGGCATCGCAGG - Intergenic
1104799933 12:131547569-131547591 CTCCTTCTCCAGGGCATCTCGGG - Intergenic
1105340843 13:19523888-19523910 GCACACTTCCAGGGCATCTCTGG - Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1111978199 13:94989727-94989749 CTCCACATCCCTGCCATCACTGG + Intergenic
1112597487 13:100821574-100821596 CTCCAATTCAAAGGCATCCCGGG - Intergenic
1117742542 14:58833733-58833755 CTCCACCTCCAGGGTACCATGGG - Intergenic
1117839024 14:59838355-59838377 TTCCACTTCCAGGAATTCACAGG + Intronic
1118561056 14:67083267-67083289 CCCCACTTCCAGCACAGCACTGG - Intronic
1119678766 14:76576179-76576201 CTCCACCTCCATGGCGTCAGGGG - Intergenic
1122623842 14:103074274-103074296 CTCCAGTCCCAGGACAGCACTGG - Intergenic
1125344647 15:38706802-38706824 CTTCAGTTCCAGGTCATCAAAGG - Intergenic
1126861297 15:52885605-52885627 CTTCATTTGCAGGGCATCAAGGG - Intergenic
1131558338 15:93418375-93418397 CTCCCGGTCCAGGGCATCCCAGG - Intergenic
1132788073 16:1669191-1669213 CTCCTTTTCCAGGGCAGCAGGGG + Intronic
1133221396 16:4320577-4320599 GTCCACTGCAAGGGCATGACGGG + Intronic
1138397351 16:56715593-56715615 CTCCACTTCCCTGGGATTACAGG - Intronic
1140376943 16:74452300-74452322 TTCCTCCTCCAGGGCAGCACAGG - Intronic
1140409667 16:74734207-74734229 CTCCACTTCCCAGGCATCTGGGG + Intronic
1141624328 16:85253396-85253418 CCCCATTTCCAGGGCCACACAGG - Intergenic
1143308423 17:5968378-5968400 CTCCACCTCAAGGCCAGCACTGG + Intronic
1144493210 17:15731927-15731949 CTCCCCATCCAGGGCATTCCTGG - Intergenic
1144907046 17:18644725-18644747 CTCCCCATCCAGGGCATTCCTGG + Intronic
1145013508 17:19382796-19382818 CTCCACCTGCAGGGAATGACAGG - Exonic
1145315652 17:21731217-21731239 CTCCATTTCCAGGTCACCCCCGG - Intergenic
1145714087 17:27003156-27003178 CTCCATTTCCAGGTCACCCCTGG - Intergenic
1146794478 17:35771772-35771794 CTCCTCTGCCAGGGCACCTCTGG + Intronic
1147429353 17:40362045-40362067 CCCACCTGCCAGGGCATCACAGG - Intronic
1148202419 17:45758106-45758128 TTCCACTTCCACGGCAGCACTGG - Intergenic
1148521606 17:48281436-48281458 CTCCACTTGGAGAGCATCACAGG - Intronic
1151057977 17:71055968-71055990 CTCCACATCCAAGGCATGATGGG + Intergenic
1152519293 17:80845937-80845959 CTCCACTGCCGGGCCCTCACCGG + Intronic
1155285448 18:24283713-24283735 TTCCACTTTCAGGGCATAAATGG + Intronic
1157294572 18:46433390-46433412 CTGCAGTTCCAGGACGTCACAGG + Exonic
1159815989 18:73074478-73074500 CTCCAAATCCAGGCCATCTCTGG - Intergenic
1161404527 19:4084154-4084176 CTCCAGTTCCAGGTCGCCACTGG + Intergenic
1161486685 19:4539675-4539697 CTCCTCCTCCAGGGCTTCCCTGG + Intronic
1161706262 19:5823524-5823546 CTCCATGTCCAGGGCAGCTCTGG + Intergenic
1162117763 19:8441921-8441943 CTCCACTCCCATGGCCACACAGG - Intronic
1164772126 19:30817332-30817354 CTCCACATCCAGGGCAGCAGAGG + Intergenic
1165498865 19:36171666-36171688 CTCCAATTCCTGGGCTTCAGTGG - Intergenic
1166745597 19:45140527-45140549 GACCTCTTCCAGGGCCTCACAGG - Exonic
925608525 2:5683691-5683713 CTCTCCTTCCAGGGCAGCTCTGG - Intergenic
925740323 2:6999920-6999942 CCCCACTACCAAGGCATCCCAGG + Intronic
926231419 2:11007015-11007037 CTTCATTTGCAGGGGATCACAGG - Intergenic
926810972 2:16755193-16755215 CTTCACTTCCAGGTCATCACAGG + Intergenic
927021734 2:19024273-19024295 CTGCACTTGCAGAGCATCTCTGG - Intergenic
929037276 2:37706308-37706330 CTCCTCCTCCAGGGCCTCTCTGG + Intronic
930214031 2:48674242-48674264 CTCCACATCCTGGCCAGCACTGG + Intronic
932158112 2:69436911-69436933 CTCCTCTTTCAGGGCCTTACTGG + Intronic
932451648 2:71814330-71814352 CTCTACTTCAAGGGCTCCACTGG + Intergenic
936928657 2:117763976-117763998 CTTCACTACCATGGCATCCCTGG - Intergenic
938672377 2:133598535-133598557 CTCCATTTCCTGTCCATCACTGG - Intergenic
941125335 2:161577638-161577660 CTCTCCTTCCAGGGCTTCAATGG + Intronic
941916074 2:170814920-170814942 CTTCCTTTCCAGGGAATCACGGG + Intronic
942623366 2:177872354-177872376 CTCCTCTTCCAGGGTATCACTGG - Intronic
947594030 2:231399737-231399759 GTCCACTTCCAGGGCCAAACCGG - Exonic
947671825 2:231941840-231941862 CGCCATTTCCAGGGCATCCTGGG - Intergenic
948559902 2:238845910-238845932 CTGCCCTTCCAGGGCGTCCCCGG + Intergenic
948616212 2:239201006-239201028 CTTCACTACCGGGGAATCACAGG + Intronic
1170837008 20:19893277-19893299 CTCCAATTGTATGGCATCACTGG - Intronic
1171419175 20:25006451-25006473 CACCACCTCCTGGGCTTCACAGG + Exonic
1171493510 20:25538486-25538508 CACCAGGTCCAGGGCATCAAAGG - Intronic
1172384986 20:34527876-34527898 CTCTACTCCCAGGGTAGCACAGG - Intronic
1174645239 20:52079920-52079942 CTCCCCTTCCAGGTTTTCACCGG + Intronic
1175180623 20:57144137-57144159 CTCCACATCCTGGCCAACACTGG - Intergenic
1176130620 20:63495250-63495272 CCCCACTTCAAGGGCAGCATGGG + Intronic
1176158879 20:63638474-63638496 CTCCTCTCCCAGGGCAGCCCTGG - Intergenic
1176867661 21:14063015-14063037 CTCCACCTGCAGTGTATCACGGG - Intergenic
1177387329 21:20425233-20425255 CTCCATTTGCAGGGCATAGCGGG + Intergenic
1179794276 21:43773680-43773702 ATCCAATTCCAGAGCATAACTGG - Exonic
1181386143 22:22547244-22547266 CTCCACTTCAAGTGCAGTACTGG + Intergenic
1182298847 22:29327005-29327027 GCCCTCTTGCAGGGCATCACAGG - Intergenic
1182572399 22:31248933-31248955 CACCACTTCCAGGACATAATGGG - Intronic
950113754 3:10437295-10437317 CTCCACTTCCAGGGGTTTCCTGG + Intronic
954211205 3:49098470-49098492 CCCCACTTCCAGGGCCCCAGTGG - Exonic
954412082 3:50375155-50375177 CCCCACTCCCACGGCAACACTGG - Intronic
954426170 3:50444194-50444216 CTCCACCCCCAGGGCCTGACTGG - Intronic
956320061 3:67986539-67986561 CTTCTCTTTCAGGGCATCATGGG + Intergenic
956387129 3:68731388-68731410 AACCACTTCCAGGGAATCAGTGG - Intergenic
961338464 3:126200301-126200323 CCCCAGTTCCAGGGGATCAGTGG + Intergenic
961562077 3:127737572-127737594 TTGCAATTCCAGGACATCACTGG + Intronic
964669805 3:159212525-159212547 CTCTACTTCCAGGCTATCATGGG + Intronic
965412347 3:168347931-168347953 CTCAACTTCCAGCACATCAAAGG + Intergenic
966924458 3:184635319-184635341 CTCCACTCTCAGGGCAGGACTGG + Intronic
982298984 4:153859719-153859741 CTCCCTTTCCAGGGCATGAACGG + Intergenic
985198925 4:187463499-187463521 CTCCACTTCCAGTGGGTTACGGG - Intergenic
985788982 5:1915337-1915359 CTCTACTTCCAGGCCAGCTCTGG - Intergenic
986513572 5:8535468-8535490 CTTCACTTCCAAGCCATGACGGG - Intergenic
986578892 5:9243271-9243293 CTTGGCTTACAGGGCATCACTGG + Intronic
988940979 5:36147215-36147237 CTCCAGTTTCATGGGATCACTGG - Intronic
991271388 5:64786351-64786373 TTCCACTTACACGGCCTCACTGG - Intronic
991382802 5:66049525-66049547 CTCCACTTCCACCTCATCATGGG - Intronic
997740210 5:136246369-136246391 CTACACTTCCAGGGAAGCCCTGG - Intronic
998885397 5:146688637-146688659 GTCCACTTCATTGGCATCACTGG + Intronic
1002576977 5:180179412-180179434 CTCCACTCCCTGTGCACCACTGG - Intronic
1004843516 6:19613718-19613740 CTCCATCTGCAGGGCATAACAGG - Intergenic
1007272011 6:40645031-40645053 CTACACATCCAGTGCCTCACAGG - Intergenic
1007753856 6:44086160-44086182 TTCCACTTCCAGGGCATAAAAGG - Intergenic
1008742321 6:54624615-54624637 CTCCATTTGCAGGACATCAAGGG - Intergenic
1015337455 6:132056763-132056785 CTCAACTTCCAGGGCAGGAGGGG - Intergenic
1015754784 6:136596396-136596418 CTCCCCTTCCACGCGATCACTGG - Intronic
1016451948 6:144192296-144192318 CTCATTTTGCAGGGCATCACTGG - Intergenic
1019621401 7:1994220-1994242 CGCCACACCCAGGGCAGCACAGG + Intronic
1020426391 7:8070949-8070971 CTCCACTTCCTGCTCATTACCGG + Exonic
1021592567 7:22279932-22279954 CTCCATTTCCAGGGTTTGACAGG + Intronic
1023908794 7:44539768-44539790 CTCAACTTCCAGGGAGACACAGG - Exonic
1024971721 7:55077976-55077998 CTCCACACCCACGGCGTCACCGG - Intronic
1026741775 7:72983371-72983393 CTCCACTCCCACTGCTTCACTGG - Intergenic
1026801616 7:73403799-73403821 CTCCACTCCCACTGCTTCACTGG - Intergenic
1027101960 7:75381706-75381728 CTCCACTCCCACTGCTTCACTGG + Intergenic
1028853393 7:95562295-95562317 CTCAAATTCCAGGGCATGACTGG - Intergenic
1029250465 7:99232724-99232746 CTCTCCTTCCAGGGCCTGACTGG - Intergenic
1030030823 7:105367559-105367581 GGCCAGTTACAGGGCATCACAGG + Intronic
1034890852 7:154838029-154838051 CTCCACTTGCAGGGCACTCCAGG + Intronic
1034892885 7:154856026-154856048 CTCCACTTCCGGGTCTTCAGTGG - Intronic
1034922097 7:155091708-155091730 CTGCACTTGCAAAGCATCACAGG - Intergenic
1035675159 8:1451006-1451028 ACCGAATTCCAGGGCATCACTGG + Intergenic
1039586705 8:38712967-38712989 CTCCACCTCCAAGGCATCTTTGG - Intergenic
1040531416 8:48269481-48269503 CTGCATTTCCAGGGCAGCAGTGG + Intergenic
1040724884 8:50370519-50370541 CTCCATTTTCAGGGCTTCAGTGG + Intronic
1041753188 8:61283773-61283795 CTTCACTTCCAGGACATGATAGG - Intronic
1044860257 8:96515963-96515985 CTCCCCTTCCAGCCCAACACTGG - Intronic
1045650441 8:104337291-104337313 CTGAACTTCCAGGACATCTCTGG - Intronic
1047525501 8:125630588-125630610 CTCCACATTCATGGCATCATTGG - Intergenic
1048419167 8:134260399-134260421 CTCCTCTCCCAGGGCCTCCCTGG + Intergenic
1052902751 9:33808281-33808303 GCACACTTCCAGGGCATCTCTGG - Intergenic
1053487829 9:38473611-38473633 GCACACTTCCAGGGCATCTCTGG + Intergenic
1055319550 9:75068754-75068776 CACCATCTCCAGGGCAGCACTGG + Intronic
1056771639 9:89481820-89481842 CTCCTCTTCCCAGGCATCGCAGG + Intronic
1058240251 9:102548622-102548644 CTCCACTTCTATGGCTTTACAGG - Intergenic
1058579087 9:106435428-106435450 CTGCTCTTCCAGGTCTTCACTGG + Intergenic
1060912075 9:127359110-127359132 CCCCACTGCCTGGGCATCCCTGG + Intronic
1062231886 9:135486438-135486460 CTCCCCTCCCAGGGCCTCACTGG - Exonic
1062608253 9:137358452-137358474 CTCCACTTCCTGTGCCTCCCGGG + Intronic
1185603804 X:1355589-1355611 CTCCACTTCCCGGGAACCCCAGG - Intronic
1188563262 X:31494182-31494204 TTCCACTACCAAGACATCACTGG - Intronic
1189318109 X:40069972-40069994 CTCCACTTCCAGCTCATCCCTGG - Intronic
1191108162 X:56785127-56785149 CTGCACTCCCAGGGCATTCCAGG + Intergenic
1192169560 X:68845865-68845887 CTTCAGTTCCAGGGCACCAGGGG + Intergenic
1197247631 X:124182408-124182430 CCCCCCTTCCTGGGCTTCACTGG + Intronic
1197699848 X:129591134-129591156 ATCCACCTCCAGAGCAACACTGG + Exonic
1198268692 X:135033656-135033678 CTCCATTTGCAGGACACCACAGG - Intergenic
1200273768 X:154712565-154712587 CTCCACTGCCATGGCATGAGGGG + Exonic