ID: 1072737253

View in Genome Browser
Species Human (GRCh38)
Location 10:97887579-97887601
Sequence CCAGACCCAGACGTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072737245_1072737253 24 Left 1072737245 10:97887532-97887554 CCACCACCAGCGGGACTTAGTTT 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1072737253 10:97887579-97887601 CCAGACCCAGACGTGGTGCAGGG No data
1072737246_1072737253 21 Left 1072737246 10:97887535-97887557 CCACCAGCGGGACTTAGTTTTGA 0: 1
1: 0
2: 0
3: 8
4: 50
Right 1072737253 10:97887579-97887601 CCAGACCCAGACGTGGTGCAGGG No data
1072737247_1072737253 18 Left 1072737247 10:97887538-97887560 CCAGCGGGACTTAGTTTTGAGTA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1072737253 10:97887579-97887601 CCAGACCCAGACGTGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072737253 Original CRISPR CCAGACCCAGACGTGGTGCA GGG Intronic
No off target data available for this crispr