ID: 1072742573

View in Genome Browser
Species Human (GRCh38)
Location 10:97918331-97918353
Sequence AGAGAATGACTCTTGCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072742573 Original CRISPR AGAGAATGACTCTTGCACGG AGG (reversed) Intronic
910895308 1:92063109-92063131 AGAGAATGACGCATTCATGGAGG + Exonic
913422824 1:118691509-118691531 AGAAAATGACACTTGCATTGTGG + Intergenic
914686136 1:149981278-149981300 ATAGAAGGATTCTTGCATGGGGG - Intronic
915687848 1:157653140-157653162 AGAGAGTCAGTCTTGCCCGGTGG + Intergenic
915785877 1:158611360-158611382 ACAGAATGACACTTGCTCTGGGG + Exonic
916773283 1:167935395-167935417 AGAGAATGAGTGTTTCATGGTGG + Intronic
917327322 1:173846309-173846331 AGAGACTGAGTCTTGCTCTGTGG - Intronic
920578356 1:207080062-207080084 AGCGAATGACTAATGCACTGAGG - Intronic
1062949910 10:1491090-1491112 AGAGACAGACTCTTGCTCTGTGG + Intronic
1065006550 10:21385762-21385784 AGAGAGTGTCTCTTTCACAGTGG - Intergenic
1069722968 10:70561317-70561339 TTAGAATGGCTCTTGCCCGGTGG + Intronic
1069912282 10:71766926-71766948 AGAGCAGGAATGTTGCACGGAGG - Intronic
1070154958 10:73827618-73827640 AGAGAATGGGATTTGCACGGGGG + Intronic
1072742573 10:97918331-97918353 AGAGAATGACTCTTGCACGGAGG - Intronic
1072953962 10:99872710-99872732 ACAGAATGACTCATGCTCAGAGG - Intergenic
1074534176 10:114316639-114316661 ACAGAATAGCTCTTGCAGGGTGG - Intronic
1075901198 10:126043863-126043885 AGAGAATGGTTCTGGCACGGCGG + Intronic
1076322733 10:129595481-129595503 AGAGTATGTCTGTGGCACGGGGG - Intronic
1077803229 11:5562954-5562976 TGAGAATGAGTCTTGCTCTGTGG - Intronic
1082160289 11:48882533-48882555 AGAAAATGACAATTTCACGGGGG + Intergenic
1082162077 11:48897873-48897895 AGAAAATGACAATTTCACGGGGG - Intergenic
1083969281 11:66063554-66063576 AGAGAATGCCTCTTGGAAGTGGG + Intronic
1085698939 11:78729329-78729351 AGAGAATAGCTCTTGCAGGGAGG - Intronic
1086143224 11:83521887-83521909 AGAGGTTGACTCTTGCTGGGAGG - Intronic
1086525418 11:87719679-87719701 TGAGAATGCCTCTTGCATTGTGG - Intergenic
1088543512 11:110937358-110937380 AGAGAATGACTCCAGCTGGGAGG - Intergenic
1088788092 11:113200743-113200765 AGATAATCACACTTGCACTGCGG + Intronic
1097484781 12:60182520-60182542 AGTGTATGACTCTTTCATGGAGG + Intergenic
1099133708 12:78865709-78865731 AGACATAGACTCTTGCAAGGAGG - Intronic
1102829095 12:115978942-115978964 AGAGAATGAGAATTGCATGGAGG + Intronic
1104607064 12:130197920-130197942 AGAAAATGACTCTTCCATGGAGG + Intergenic
1106115151 13:26811464-26811486 AGTGAATGTCTGCTGCACGGTGG + Intergenic
1106646532 13:31639964-31639986 AAAGTATGACTCATGCACAGGGG + Intergenic
1109766753 13:66910242-66910264 AGAAACTGACTGTTGCACGTGGG + Intronic
1110286277 13:73753376-73753398 AGAAAATGCCTCTTGAAAGGAGG - Intronic
1112618555 13:101031383-101031405 TGAGAATGATCCTTGCACTGAGG + Intergenic
1128888871 15:71312865-71312887 AGTGAAGGTCTCTTGCAGGGAGG - Intronic
1129039649 15:72675071-72675093 AGAGATGGAGTCTTGCTCGGTGG - Intergenic
1133129024 16:3664784-3664806 AGAGACTGACTCTGTCACTGAGG - Exonic
1134150380 16:11800228-11800250 TGAGAATGAGTCTTGCACAATGG + Intergenic
1137435697 16:48452910-48452932 AGAGAATGGGGCTGGCACGGTGG - Intergenic
1138075038 16:54033794-54033816 AGAGACTGGGTCTTGCTCGGTGG - Intronic
1139063724 16:63288017-63288039 AGAGAAGGAGTCATTCACGGAGG - Intergenic
1141801644 16:86313706-86313728 AGAGAAAGCCTCTTGGAAGGAGG + Intergenic
1144159725 17:12546002-12546024 AGGGCATGACTGGTGCACGGGGG - Intergenic
1144681050 17:17194746-17194768 AGAGAATCACTCGAGCATGGGGG + Intronic
1145820237 17:27827390-27827412 GGAGAATCACTCTTGCCTGGAGG + Intronic
1148538241 17:48458522-48458544 AAAGAATGAATGTAGCACGGGGG - Intergenic
1153926096 18:9836550-9836572 GGAGAATGATTCTTGTAGGGGGG - Intronic
1155435699 18:25810771-25810793 AGAGAATGCCCATTGCATGGTGG + Intergenic
1156722777 18:40090345-40090367 AGGGGATGAATCTTGCACAGTGG + Intergenic
1160708837 19:541522-541544 TGAGGATGACTCTGGCACGGAGG + Exonic
1163197545 19:15733661-15733683 TGACAATGACTTTTGCAAGGTGG + Intergenic
1166362720 19:42261234-42261256 AGAGAAAGACTCTGTCTCGGGGG - Intergenic
1166703401 19:44895136-44895158 AGTGAATGACTCGTGCAGGCGGG + Intronic
925501481 2:4509798-4509820 AGAGAATGATCCTTTCATGGAGG - Intergenic
932527598 2:72488007-72488029 AGAGAATGGCTCCTGCAGAGAGG - Intronic
933737912 2:85510124-85510146 AGAAAATGGCTCTAGCACAGTGG - Intergenic
940254939 2:151718628-151718650 AGGGAATGACTCCTGCACCCAGG + Intronic
943397542 2:187358524-187358546 AGAGGATGAATCTAGCAGGGGGG - Intronic
948036200 2:234860074-234860096 AGTGAATGACTCTAACAGGGAGG + Intergenic
1172093691 20:32450528-32450550 AGAGAATGATTCTTCCAGGGAGG - Intronic
1175671020 20:60902927-60902949 TGAGAATGACTCTTGCCCTGGGG - Intergenic
1175671036 20:60903014-60903036 TGAGAATGACTCTTGCCCTGGGG - Intergenic
1175671051 20:60903101-60903123 TGAGAATGACTCTTGCCCTGGGG - Intergenic
1175671068 20:60903188-60903210 TGAGAATGACTCTTGCCCTGGGG - Intergenic
1182319925 22:29472008-29472030 AGAGAGTGGCTCTTGCACCTGGG - Intergenic
1184031713 22:41898962-41898984 AGAGCAGGACACTTGCACAGAGG - Intronic
1184249507 22:43252204-43252226 AGAGAATACCTCGAGCACGGCGG - Intronic
1185266136 22:49905296-49905318 AGAGAGTGAGTCTTGATCGGGGG - Intronic
950716676 3:14852796-14852818 AGAGAATGCCTCCTGCACCCAGG - Intronic
956432306 3:69199520-69199542 AGAGAATCACCCCTGCATGGGGG - Intronic
958139984 3:89550001-89550023 ACAGAATTACTCTTGTACTGGGG + Intergenic
958631943 3:96696474-96696496 TGAGAATGATTCATGCACTGAGG + Intergenic
962823028 3:139071228-139071250 ATAGAATGAACCTTGTACGGAGG + Intronic
963358638 3:144241846-144241868 AGAGAATGTCTCTCTCATGGGGG + Intergenic
974406554 4:61479343-61479365 TGAGAATGGCCCTTGCATGGGGG - Intronic
978057633 4:104292080-104292102 AGAGAATGAATCTTAGTCGGAGG - Intergenic
982264655 4:153527188-153527210 AGTAAATGAATCTTGCAAGGGGG + Intronic
988881382 5:35507318-35507340 AGATCATGACTTTTGCAGGGGGG - Intergenic
989243206 5:39223629-39223651 TTAGAATTACTCTTGCATGGGGG - Intronic
991648575 5:68827985-68828007 GGAGAATAACTCTTACACAGTGG - Intergenic
995621689 5:114032571-114032593 TCAGAATGACTCTAGCACAGAGG + Intergenic
1000788879 5:165580517-165580539 AGAGAATGATTCTTGTAAAGTGG + Intergenic
1001408414 5:171493279-171493301 GGAGAATGACTATTTCACAGAGG - Intergenic
1004270690 6:14192663-14192685 AGAGCATGACTCTTGCTCCCAGG + Intergenic
1007796058 6:44348694-44348716 AGAGAAGCACTTTTGCGCGGTGG + Intronic
1010153301 6:72762081-72762103 AGCGAATGTCTCTTGCAAGTGGG - Intronic
1013534976 6:111055766-111055788 AGAGATTGACTTTTAAACGGTGG - Intergenic
1015158557 6:130125750-130125772 AGAGAATGCCCCTTGCAGTGTGG + Intronic
1015554420 6:134446028-134446050 AGAGAATGTCTTTTGAACTGTGG - Intergenic
1016117565 6:140306110-140306132 AGAGGATGACTGTTCCACTGAGG - Intergenic
1024269962 7:47634907-47634929 ATAGAATGACTTTTGCTTGGAGG + Intergenic
1026190795 7:68124595-68124617 AAAGAATGAGCCTTGCACTGTGG - Intergenic
1036955126 8:13179699-13179721 TGAGACTGAGTCTTGCACTGTGG - Intronic
1037640837 8:20741723-20741745 ACAAGATGACTGTTGCACGGAGG - Intergenic
1037764800 8:21766007-21766029 AAAAGATGACTCTTGCACTGTGG - Intronic
1041390979 8:57347325-57347347 GGAGAGTGTCTCTTGCAAGGTGG - Intergenic
1049233586 8:141496734-141496756 AGAACCTGACACTTGCACGGAGG - Intergenic
1051034199 9:12723571-12723593 AGTGAATGACTCTTGCCTGGTGG - Intergenic
1053314201 9:37037732-37037754 AGGGAACGACTCTGGCACTGGGG + Intergenic
1054878472 9:70121086-70121108 AGAGGATGCCTCTGGCACCGCGG + Intronic
1056063308 9:82907214-82907236 ACAGAATGACCCTTCCATGGAGG - Intergenic
1058690359 9:107515245-107515267 AGAGAATGACTGATGTAGGGCGG + Intergenic
1059793607 9:117667129-117667151 AGAGCAAGACTCTAGCACAGTGG + Intergenic
1061544574 9:131297062-131297084 AGGGACTGACTGTTGCACTGAGG - Intronic
1061923730 9:133795897-133795919 AGAGAGTGACTCCTCCACAGGGG + Intronic
1062353451 9:136150217-136150239 AGAGAATGGCTCTGCCACAGCGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1190516083 X:51224876-51224898 ACAGAAAAACTCTTGCACAGAGG - Intergenic
1192325715 X:70130326-70130348 AGAGAATAACTTTGGCCCGGAGG - Intergenic
1195799449 X:108690679-108690701 AGAGTATGACTCTTACAAAGTGG - Intronic
1196997215 X:121397193-121397215 AGAGACTCACTCTGGCACTGTGG - Intergenic